Incidental Mutation 'R3935:Tmem80'
ID307133
Institutional Source Beutler Lab
Gene Symbol Tmem80
Ensembl Gene ENSMUSG00000025505
Gene Nametransmembrane protein 80
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R3935 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location141327739-141337156 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141334025 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 30 (Y30H)
Ref Sequence ENSEMBL: ENSMUSP00000116695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026577] [ENSMUST00000026578] [ENSMUST00000126510] [ENSMUST00000128906] [ENSMUST00000132061] [ENSMUST00000133012] [ENSMUST00000143633] [ENSMUST00000145184]
Predicted Effect probably benign
Transcript: ENSMUST00000026577
SMART Domains Protein: ENSMUSP00000026577
Gene: ENSMUSG00000025504

DomainStartEndE-ValueType
Pfam:PTB 51 181 6.6e-50 PFAM
Pfam:PID 52 175 5.9e-9 PFAM
low complexity region 196 209 N/A INTRINSIC
low complexity region 284 299 N/A INTRINSIC
SH3 498 553 2.11e-15 SMART
PDB:1WWU|A 614 700 2e-46 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000026578
AA Change: Y30H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000026578
Gene: ENSMUSG00000025505
AA Change: Y30H

DomainStartEndE-ValueType
Pfam:Transmemb_17 1 108 2.4e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000126510
AA Change: Y30H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000123330
Gene: ENSMUSG00000025505
AA Change: Y30H

DomainStartEndE-ValueType
Pfam:Transmemb_17 1 109 1e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128649
Predicted Effect probably benign
Transcript: ENSMUST00000128906
SMART Domains Protein: ENSMUSP00000117306
Gene: ENSMUSG00000025505

DomainStartEndE-ValueType
transmembrane domain 5 22 N/A INTRINSIC
Pfam:Transmemb_17 25 78 5.4e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000132061
AA Change: Y30H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000118223
Gene: ENSMUSG00000025505
AA Change: Y30H

DomainStartEndE-ValueType
Pfam:Transmemb_17 1 109 1e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000133012
AA Change: Y30H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000116695
Gene: ENSMUSG00000025505
AA Change: Y30H

DomainStartEndE-ValueType
Pfam:Transmemb_17 1 109 1e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134221
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136736
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140025
Predicted Effect probably benign
Transcript: ENSMUST00000143633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145108
Predicted Effect probably benign
Transcript: ENSMUST00000145184
SMART Domains Protein: ENSMUSP00000117633
Gene: ENSMUSG00000025505

DomainStartEndE-ValueType
transmembrane domain 5 22 N/A INTRINSIC
Pfam:Transmemb_17 25 78 5.4e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155657
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210251
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arx T A X: 93,297,369 L554Q probably damaging Het
Baz2b A G 2: 59,912,761 V1622A possibly damaging Het
Bbof1 A G 12: 84,411,210 D83G probably damaging Het
Ccdc47 T C 11: 106,201,997 probably benign Het
Clstn3 G A 6: 124,457,942 T338I probably damaging Het
Dsc1 T A 18: 20,097,241 T336S probably benign Het
Elk3 A G 10: 93,265,173 S239P possibly damaging Het
Fbll1 T A 11: 35,797,648 I263F probably damaging Het
Fbxw8 T G 5: 118,095,718 I283L probably benign Het
Fcgbp T C 7: 28,075,399 F133L probably benign Het
Gpr176 A G 2: 118,279,296 V494A probably benign Het
Gpr85 A G 6: 13,836,045 F287L probably benign Het
Hoxd11 A G 2: 74,684,032 N302S probably benign Het
Iqgap1 T G 7: 80,743,837 Y664S possibly damaging Het
Kansl1 A T 11: 104,343,543 D712E possibly damaging Het
Kif1b T C 4: 149,237,160 N1101D probably benign Het
Kyat1 A G 2: 30,185,749 L376P probably damaging Het
Lztr1 T A 16: 17,522,195 Y93* probably null Het
Nrip1 A G 16: 76,294,435 M78T possibly damaging Het
P4hb A C 11: 120,562,409 H440Q probably benign Het
Pbsn T C X: 77,848,096 T32A probably damaging Het
Prg4 A G 1: 150,458,157 I152T possibly damaging Het
Prss36 A G 7: 127,934,608 L8P probably damaging Het
Prune2 T C 19: 17,199,786 V2930A probably damaging Het
Ptchd4 G C 17: 42,503,489 L760F possibly damaging Het
Rbms3 A G 9: 116,636,391 L163P probably damaging Het
Scn1a T C 2: 66,327,776 I418V probably damaging Het
Sf3a1 T A 11: 4,180,024 probably null Het
Sirpb1b T A 3: 15,548,783 T80S probably benign Het
Slc16a7 C A 10: 125,230,843 R309L probably damaging Het
Slc35f1 C T 10: 53,108,218 T358I probably damaging Het
Slmap T C 14: 26,459,415 E411G probably benign Het
Ssu72 C T 4: 155,705,419 S13L probably benign Het
Sult2b1 C T 7: 45,742,216 V49M probably benign Het
Other mutations in Tmem80
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0537:Tmem80 UTSW 7 141333696 missense probably damaging 1.00
R0539:Tmem80 UTSW 7 141335895 missense possibly damaging 0.67
R4112:Tmem80 UTSW 7 141333779 intron probably benign
R6442:Tmem80 UTSW 7 141335926 missense probably benign 0.01
Z1177:Tmem80 UTSW 7 141328266 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCCTAGCTACACTCCTGATGATTG -3'
(R):5'- AGGCTGCCTGAATGACAGTG -3'

Sequencing Primer
(F):5'- TCCAGAGGTCCTGAGTTCAAATC -3'
(R):5'- TGCCTGAATGACAGTGACTCC -3'
Posted On2015-04-17