Incidental Mutation 'R3935:Rbms3'
ID307134
Institutional Source Beutler Lab
Gene Symbol Rbms3
Ensembl Gene ENSMUSG00000039607
Gene NameRNA binding motif, single stranded interacting protein
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R3935 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location116572746-117629913 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116636391 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 163 (L163P)
Ref Sequence ENSEMBL: ENSMUSP00000133900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044901] [ENSMUST00000068962] [ENSMUST00000111772] [ENSMUST00000111773] [ENSMUST00000164018] [ENSMUST00000173429] [ENSMUST00000174868]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044901
AA Change: L338P

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000039706
Gene: ENSMUSG00000039607
AA Change: L338P

DomainStartEndE-ValueType
low complexity region 27 49 N/A INTRINSIC
RRM 57 125 1.2e-17 SMART
RRM 136 208 1.49e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000068962
AA Change: L321P

PolyPhen 2 Score 0.868 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000066735
Gene: ENSMUSG00000039607
AA Change: L321P

DomainStartEndE-ValueType
low complexity region 27 49 N/A INTRINSIC
RRM 57 125 1.2e-17 SMART
RRM 136 208 1.49e-13 SMART
low complexity region 384 394 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111772
AA Change: L338P

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107402
Gene: ENSMUSG00000039607
AA Change: L338P

DomainStartEndE-ValueType
low complexity region 27 49 N/A INTRINSIC
RRM 57 125 1.2e-17 SMART
RRM 136 208 1.49e-13 SMART
low complexity region 385 395 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111773
AA Change: L338P

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107403
Gene: ENSMUSG00000039607
AA Change: L338P

DomainStartEndE-ValueType
low complexity region 27 49 N/A INTRINSIC
RRM 57 125 1.2e-17 SMART
RRM 136 208 1.49e-13 SMART
low complexity region 401 411 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164018
AA Change: L370P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131371
Gene: ENSMUSG00000039607
AA Change: L370P

DomainStartEndE-ValueType
low complexity region 76 98 N/A INTRINSIC
RRM 106 174 1.2e-17 SMART
RRM 185 257 1.49e-13 SMART
low complexity region 433 443 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172469
SMART Domains Protein: ENSMUSP00000134172
Gene: ENSMUSG00000039607

DomainStartEndE-ValueType
Pfam:RRM_1 1 50 9.8e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173429
AA Change: L163P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133900
Gene: ENSMUSG00000039607
AA Change: L163P

DomainStartEndE-ValueType
Blast:RRM 1 50 2e-29 BLAST
PDB:1X5O|A 1 60 3e-31 PDB
SCOP:d1h6kx_ 1 62 4e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000174868
AA Change: L338P

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133621
Gene: ENSMUSG00000039607
AA Change: L338P

DomainStartEndE-ValueType
low complexity region 27 49 N/A INTRINSIC
RRM 57 125 1.2e-17 SMART
RRM 136 208 1.49e-13 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein that belongs to the c-myc gene single-strand binding protein family. These proteins are characterized by the presence of two sets of ribonucleoprotein consensus sequence (RNP-CS) that contain conserved motifs, RNP1 and RNP2, originally described in RNA binding proteins, and required for DNA binding. These proteins have been implicated in such diverse functions as DNA replication, gene transcription, cell cycle progression and apoptosis. The encoded protein was isolated by virtue of its binding to an upstream element of the alpha2(I) collagen promoter. The observation that this protein localizes mostly in the cytoplasm suggests that it may be involved in a cytoplasmic function such as controlling RNA metabolism, rather than transcription. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arx T A X: 93,297,369 L554Q probably damaging Het
Baz2b A G 2: 59,912,761 V1622A possibly damaging Het
Bbof1 A G 12: 84,411,210 D83G probably damaging Het
Ccdc47 T C 11: 106,201,997 probably benign Het
Clstn3 G A 6: 124,457,942 T338I probably damaging Het
Dsc1 T A 18: 20,097,241 T336S probably benign Het
Elk3 A G 10: 93,265,173 S239P possibly damaging Het
Fbll1 T A 11: 35,797,648 I263F probably damaging Het
Fbxw8 T G 5: 118,095,718 I283L probably benign Het
Fcgbp T C 7: 28,075,399 F133L probably benign Het
Gpr176 A G 2: 118,279,296 V494A probably benign Het
Gpr85 A G 6: 13,836,045 F287L probably benign Het
Hoxd11 A G 2: 74,684,032 N302S probably benign Het
Iqgap1 T G 7: 80,743,837 Y664S possibly damaging Het
Kansl1 A T 11: 104,343,543 D712E possibly damaging Het
Kif1b T C 4: 149,237,160 N1101D probably benign Het
Kyat1 A G 2: 30,185,749 L376P probably damaging Het
Lztr1 T A 16: 17,522,195 Y93* probably null Het
Nrip1 A G 16: 76,294,435 M78T possibly damaging Het
P4hb A C 11: 120,562,409 H440Q probably benign Het
Pbsn T C X: 77,848,096 T32A probably damaging Het
Prg4 A G 1: 150,458,157 I152T possibly damaging Het
Prss36 A G 7: 127,934,608 L8P probably damaging Het
Prune2 T C 19: 17,199,786 V2930A probably damaging Het
Ptchd4 G C 17: 42,503,489 L760F possibly damaging Het
Scn1a T C 2: 66,327,776 I418V probably damaging Het
Sf3a1 T A 11: 4,180,024 probably null Het
Sirpb1b T A 3: 15,548,783 T80S probably benign Het
Slc16a7 C A 10: 125,230,843 R309L probably damaging Het
Slc35f1 C T 10: 53,108,218 T358I probably damaging Het
Slmap T C 14: 26,459,415 E411G probably benign Het
Ssu72 C T 4: 155,705,419 S13L probably benign Het
Sult2b1 C T 7: 45,742,216 V49M probably benign Het
Tmem80 T C 7: 141,334,025 Y30H probably damaging Het
Other mutations in Rbms3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Rbms3 APN 9 117110115 missense probably damaging 0.99
IGL01859:Rbms3 APN 9 116959538 missense probably damaging 1.00
IGL01962:Rbms3 APN 9 116695811 splice site probably benign
IGL03034:Rbms3 APN 9 117251811 utr 5 prime probably benign
PIT4810001:Rbms3 UTSW 9 117056793 missense probably damaging 0.98
R0862:Rbms3 UTSW 9 117629792 splice site probably benign
R0864:Rbms3 UTSW 9 117629792 splice site probably benign
R0939:Rbms3 UTSW 9 117109960 critical splice donor site probably null
R1796:Rbms3 UTSW 9 116719333 missense probably damaging 1.00
R1808:Rbms3 UTSW 9 116822826 missense probably damaging 1.00
R1826:Rbms3 UTSW 9 116822868 missense probably damaging 1.00
R2213:Rbms3 UTSW 9 116959466 critical splice donor site probably null
R3719:Rbms3 UTSW 9 116582862 missense probably benign 0.11
R4270:Rbms3 UTSW 9 117056748 missense probably damaging 1.00
R4822:Rbms3 UTSW 9 116944373 intron probably benign
R4943:Rbms3 UTSW 9 116678505 intron probably benign
R5445:Rbms3 UTSW 9 117251785 missense possibly damaging 0.74
R5997:Rbms3 UTSW 9 116719389 missense probably damaging 1.00
R6848:Rbms3 UTSW 9 117251741 missense probably damaging 1.00
R6944:Rbms3 UTSW 9 117110105 missense probably damaging 0.99
R7205:Rbms3 UTSW 9 116586017 critical splice donor site probably null
R7419:Rbms3 UTSW 9 116822826 missense probably damaging 1.00
R8267:Rbms3 UTSW 9 117056755 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GTCTCAAGTCTAAAGGCAACGC -3'
(R):5'- ACTCACCAAAGGCTGTATTGG -3'

Sequencing Primer
(F):5'- CCTCCTTGCACGTGTGAATGAG -3'
(R):5'- GCTGTATTGGCTTTTGATAAAGAACG -3'
Posted On2015-04-17