Incidental Mutation 'R3935:Slc35f1'
ID307135
Institutional Source Beutler Lab
Gene Symbol Slc35f1
Ensembl Gene ENSMUSG00000038602
Gene Namesolute carrier family 35, member F1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3935 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location52690533-53111622 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 53108218 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 358 (T358I)
Ref Sequence ENSEMBL: ENSMUSP00000101113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105473]
Predicted Effect probably damaging
Transcript: ENSMUST00000105473
AA Change: T358I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101113
Gene: ENSMUSG00000038602
AA Change: T358I

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:SLC35F 56 355 1.4e-151 PFAM
Pfam:CRT-like 66 315 2.3e-13 PFAM
Pfam:EamA 217 355 1.7e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218783
Meta Mutation Damage Score 0.3129 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit no detectable phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arx T A X: 93,297,369 L554Q probably damaging Het
Baz2b A G 2: 59,912,761 V1622A possibly damaging Het
Bbof1 A G 12: 84,411,210 D83G probably damaging Het
Ccdc47 T C 11: 106,201,997 probably benign Het
Clstn3 G A 6: 124,457,942 T338I probably damaging Het
Dsc1 T A 18: 20,097,241 T336S probably benign Het
Elk3 A G 10: 93,265,173 S239P possibly damaging Het
Fbll1 T A 11: 35,797,648 I263F probably damaging Het
Fbxw8 T G 5: 118,095,718 I283L probably benign Het
Fcgbp T C 7: 28,075,399 F133L probably benign Het
Gpr176 A G 2: 118,279,296 V494A probably benign Het
Gpr85 A G 6: 13,836,045 F287L probably benign Het
Hoxd11 A G 2: 74,684,032 N302S probably benign Het
Iqgap1 T G 7: 80,743,837 Y664S possibly damaging Het
Kansl1 A T 11: 104,343,543 D712E possibly damaging Het
Kif1b T C 4: 149,237,160 N1101D probably benign Het
Kyat1 A G 2: 30,185,749 L376P probably damaging Het
Lztr1 T A 16: 17,522,195 Y93* probably null Het
Nrip1 A G 16: 76,294,435 M78T possibly damaging Het
P4hb A C 11: 120,562,409 H440Q probably benign Het
Pbsn T C X: 77,848,096 T32A probably damaging Het
Prg4 A G 1: 150,458,157 I152T possibly damaging Het
Prss36 A G 7: 127,934,608 L8P probably damaging Het
Prune2 T C 19: 17,199,786 V2930A probably damaging Het
Ptchd4 G C 17: 42,503,489 L760F possibly damaging Het
Rbms3 A G 9: 116,636,391 L163P probably damaging Het
Scn1a T C 2: 66,327,776 I418V probably damaging Het
Sf3a1 T A 11: 4,180,024 probably null Het
Sirpb1b T A 3: 15,548,783 T80S probably benign Het
Slc16a7 C A 10: 125,230,843 R309L probably damaging Het
Slmap T C 14: 26,459,415 E411G probably benign Het
Ssu72 C T 4: 155,705,419 S13L probably benign Het
Sult2b1 C T 7: 45,742,216 V49M probably benign Het
Tmem80 T C 7: 141,334,025 Y30H probably damaging Het
Other mutations in Slc35f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Slc35f1 APN 10 53062452 missense probably damaging 1.00
IGL01073:Slc35f1 APN 10 53021960 missense probably benign 0.16
IGL01433:Slc35f1 APN 10 53073446 splice site probably benign
IGL01566:Slc35f1 APN 10 53089455 missense probably damaging 1.00
IGL02693:Slc35f1 APN 10 52933128 missense probably damaging 1.00
IGL02870:Slc35f1 APN 10 52933207 missense possibly damaging 0.82
IGL03082:Slc35f1 APN 10 52933138 missense probably benign
R0884:Slc35f1 UTSW 10 53089347 missense probably damaging 1.00
R1340:Slc35f1 UTSW 10 53089454 missense probably damaging 1.00
R1781:Slc35f1 UTSW 10 53062436 splice site probably null
R1813:Slc35f1 UTSW 10 52933195 missense probably damaging 1.00
R1908:Slc35f1 UTSW 10 53021904 missense possibly damaging 0.84
R2044:Slc35f1 UTSW 10 53089347 missense probably damaging 1.00
R2518:Slc35f1 UTSW 10 53073534 missense probably benign 0.07
R3872:Slc35f1 UTSW 10 53021910 missense possibly damaging 0.87
R3934:Slc35f1 UTSW 10 53108218 missense probably damaging 1.00
R3936:Slc35f1 UTSW 10 53108218 missense probably damaging 1.00
R4118:Slc35f1 UTSW 10 53089368 missense probably damaging 0.98
R4921:Slc35f1 UTSW 10 53062602 missense probably damaging 0.99
R5116:Slc35f1 UTSW 10 53021895 missense probably benign 0.39
R5378:Slc35f1 UTSW 10 52691061 missense possibly damaging 0.86
R5387:Slc35f1 UTSW 10 53108164 missense probably damaging 1.00
R5500:Slc35f1 UTSW 10 52933222 missense probably damaging 0.99
R5590:Slc35f1 UTSW 10 53108178 missense possibly damaging 0.63
R5743:Slc35f1 UTSW 10 53089450 missense probably benign 0.06
R5916:Slc35f1 UTSW 10 52933221 nonsense probably null
R6985:Slc35f1 UTSW 10 53021911 missense probably benign 0.02
R7068:Slc35f1 UTSW 10 53062500 missense probably damaging 1.00
R7295:Slc35f1 UTSW 10 53062541 missense probably benign 0.00
R7427:Slc35f1 UTSW 10 53089414 missense probably damaging 1.00
R7428:Slc35f1 UTSW 10 53089414 missense probably damaging 1.00
R8334:Slc35f1 UTSW 10 53108148 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- CACTTTCCATCAAGAGTATCAGCTAC -3'
(R):5'- AACACATGGCCTCTGAGTTGTC -3'

Sequencing Primer
(F):5'- GAGTATCAGCTACCTCATCAAATTGC -3'
(R):5'- GAGTTGTCCTCAGTGGGC -3'
Posted On2015-04-17