Incidental Mutation 'R3935:Slmap'
ID307146
Institutional Source Beutler Lab
Gene Symbol Slmap
Ensembl Gene ENSMUSG00000021870
Gene Namesarcolemma associated protein
SynonymsD330001L02Rik, Slap
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3935 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location26413168-26534931 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26459415 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 411 (E411G)
Ref Sequence ENSEMBL: ENSMUSP00000117816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038522] [ENSMUST00000090359] [ENSMUST00000102956] [ENSMUST00000112330] [ENSMUST00000112331] [ENSMUST00000139075]
Predicted Effect probably benign
Transcript: ENSMUST00000038522
AA Change: E411G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000046956
Gene: ENSMUSG00000021870
AA Change: E411G

DomainStartEndE-ValueType
FHA 27 85 1.05e-8 SMART
coiled coil region 167 199 N/A INTRINSIC
coiled coil region 230 390 N/A INTRINSIC
coiled coil region 486 568 N/A INTRINSIC
coiled coil region 595 794 N/A INTRINSIC
transmembrane domain 796 818 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090359
SMART Domains Protein: ENSMUSP00000087836
Gene: ENSMUSG00000021870

DomainStartEndE-ValueType
FHA 27 85 1.05e-8 SMART
coiled coil region 167 199 N/A INTRINSIC
coiled coil region 230 390 N/A INTRINSIC
coiled coil region 490 572 N/A INTRINSIC
coiled coil region 599 799 N/A INTRINSIC
transmembrane domain 801 823 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102956
AA Change: E411G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000100021
Gene: ENSMUSG00000021870
AA Change: E411G

DomainStartEndE-ValueType
FHA 27 85 1.05e-8 SMART
coiled coil region 167 199 N/A INTRINSIC
coiled coil region 230 390 N/A INTRINSIC
coiled coil region 486 568 N/A INTRINSIC
coiled coil region 595 794 N/A INTRINSIC
transmembrane domain 796 818 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112330
SMART Domains Protein: ENSMUSP00000107949
Gene: ENSMUSG00000021870

DomainStartEndE-ValueType
FHA 27 85 1.05e-8 SMART
coiled coil region 167 199 N/A INTRINSIC
coiled coil region 230 383 N/A INTRINSIC
coiled coil region 452 534 N/A INTRINSIC
coiled coil region 561 761 N/A INTRINSIC
transmembrane domain 763 785 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112331
SMART Domains Protein: ENSMUSP00000107950
Gene: ENSMUSG00000021870

DomainStartEndE-ValueType
coiled coil region 46 78 N/A INTRINSIC
coiled coil region 109 260 N/A INTRINSIC
coiled coil region 352 434 N/A INTRINSIC
coiled coil region 461 661 N/A INTRINSIC
transmembrane domain 663 685 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139075
AA Change: E411G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117816
Gene: ENSMUSG00000021870
AA Change: E411G

DomainStartEndE-ValueType
FHA 27 85 1.05e-8 SMART
coiled coil region 167 199 N/A INTRINSIC
coiled coil region 230 390 N/A INTRINSIC
coiled coil region 507 589 N/A INTRINSIC
coiled coil region 616 816 N/A INTRINSIC
transmembrane domain 818 840 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142679
SMART Domains Protein: ENSMUSP00000123072
Gene: ENSMUSG00000021870

DomainStartEndE-ValueType
coiled coil region 1 52 N/A INTRINSIC
coiled coil region 97 179 N/A INTRINSIC
coiled coil region 206 405 N/A INTRINSIC
transmembrane domain 408 430 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144737
Predicted Effect probably benign
Transcript: ENSMUST00000145738
SMART Domains Protein: ENSMUSP00000117276
Gene: ENSMUSG00000021870

DomainStartEndE-ValueType
coiled coil region 1 59 N/A INTRINSIC
coiled coil region 138 220 N/A INTRINSIC
coiled coil region 247 447 N/A INTRINSIC
transmembrane domain 450 472 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000146438
AA Change: E157G
SMART Domains Protein: ENSMUSP00000123344
Gene: ENSMUSG00000021870
AA Change: E157G

DomainStartEndE-ValueType
coiled coil region 17 142 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of a conserved striatin-interacting phosphatase and kinase complex. Striatin family complexes participate in a variety of cellular processes including signaling, cell cycle control, cell migration, Golgi assembly, and apoptosis. The protein encoded by this gene is a coiled-coil, tail-anchored membrane protein with a single C-terminal transmembrane domain that is posttranslationally inserted into membranes. Mutations in this gene are associated with Brugada syndrome, a cardiac channelopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
PHENOTYPE: Homozygous inactivation in this locus affects T cell development. Mice homozygous for a transposon induced allele exhibit cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arx T A X: 93,297,369 L554Q probably damaging Het
Baz2b A G 2: 59,912,761 V1622A possibly damaging Het
Bbof1 A G 12: 84,411,210 D83G probably damaging Het
Ccdc47 T C 11: 106,201,997 probably benign Het
Clstn3 G A 6: 124,457,942 T338I probably damaging Het
Dsc1 T A 18: 20,097,241 T336S probably benign Het
Elk3 A G 10: 93,265,173 S239P possibly damaging Het
Fbll1 T A 11: 35,797,648 I263F probably damaging Het
Fbxw8 T G 5: 118,095,718 I283L probably benign Het
Fcgbp T C 7: 28,075,399 F133L probably benign Het
Gpr176 A G 2: 118,279,296 V494A probably benign Het
Gpr85 A G 6: 13,836,045 F287L probably benign Het
Hoxd11 A G 2: 74,684,032 N302S probably benign Het
Iqgap1 T G 7: 80,743,837 Y664S possibly damaging Het
Kansl1 A T 11: 104,343,543 D712E possibly damaging Het
Kif1b T C 4: 149,237,160 N1101D probably benign Het
Kyat1 A G 2: 30,185,749 L376P probably damaging Het
Lztr1 T A 16: 17,522,195 Y93* probably null Het
Nrip1 A G 16: 76,294,435 M78T possibly damaging Het
P4hb A C 11: 120,562,409 H440Q probably benign Het
Pbsn T C X: 77,848,096 T32A probably damaging Het
Prg4 A G 1: 150,458,157 I152T possibly damaging Het
Prss36 A G 7: 127,934,608 L8P probably damaging Het
Prune2 T C 19: 17,199,786 V2930A probably damaging Het
Ptchd4 G C 17: 42,503,489 L760F possibly damaging Het
Rbms3 A G 9: 116,636,391 L163P probably damaging Het
Scn1a T C 2: 66,327,776 I418V probably damaging Het
Sf3a1 T A 11: 4,180,024 probably null Het
Sirpb1b T A 3: 15,548,783 T80S probably benign Het
Slc16a7 C A 10: 125,230,843 R309L probably damaging Het
Slc35f1 C T 10: 53,108,218 T358I probably damaging Het
Ssu72 C T 4: 155,705,419 S13L probably benign Het
Sult2b1 C T 7: 45,742,216 V49M probably benign Het
Tmem80 T C 7: 141,334,025 Y30H probably damaging Het
Other mutations in Slmap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02402:Slmap APN 14 26463710 missense probably damaging 0.97
IGL02612:Slmap APN 14 26459466 splice site probably benign
IGL02630:Slmap APN 14 26422431 missense possibly damaging 0.93
IGL02798:Slmap APN 14 26470378 missense possibly damaging 0.88
PIT4382001:Slmap UTSW 14 26533431 missense probably damaging 1.00
R0433:Slmap UTSW 14 26453594 nonsense probably null
R0963:Slmap UTSW 14 26468520 missense probably damaging 1.00
R1721:Slmap UTSW 14 26460218 splice site probably benign
R1848:Slmap UTSW 14 26422574 missense probably benign
R2151:Slmap UTSW 14 26418247 missense probably damaging 1.00
R2152:Slmap UTSW 14 26418247 missense probably damaging 1.00
R2153:Slmap UTSW 14 26418247 missense probably damaging 1.00
R2154:Slmap UTSW 14 26418247 missense probably damaging 1.00
R3725:Slmap UTSW 14 26427242 missense probably damaging 0.99
R3726:Slmap UTSW 14 26427242 missense probably damaging 0.99
R4118:Slmap UTSW 14 26482872 missense probably damaging 0.99
R4594:Slmap UTSW 14 26465617 missense probably damaging 1.00
R4731:Slmap UTSW 14 26468535 missense probably damaging 0.97
R4732:Slmap UTSW 14 26468535 missense probably damaging 0.97
R4733:Slmap UTSW 14 26468535 missense probably damaging 0.97
R4817:Slmap UTSW 14 26462352 missense probably damaging 0.97
R4847:Slmap UTSW 14 26426608 missense possibly damaging 0.90
R4860:Slmap UTSW 14 26460209 missense probably benign 0.22
R4860:Slmap UTSW 14 26460209 missense probably benign 0.22
R5092:Slmap UTSW 14 26463589 missense probably damaging 1.00
R5211:Slmap UTSW 14 26482962 missense probably damaging 1.00
R5387:Slmap UTSW 14 26459933 missense probably benign 0.22
R5821:Slmap UTSW 14 26462280 missense probably damaging 1.00
R6404:Slmap UTSW 14 26422411 splice site probably null
R6856:Slmap UTSW 14 26430092 splice site probably null
R6977:Slmap UTSW 14 26533419 missense probably damaging 1.00
R7108:Slmap UTSW 14 26422521 missense probably benign 0.04
R7320:Slmap UTSW 14 26460072 missense possibly damaging 0.53
R7470:Slmap UTSW 14 26427420 missense probably benign
R7520:Slmap UTSW 14 26427420 missense probably benign
R7540:Slmap UTSW 14 26460191 missense probably damaging 0.99
R7544:Slmap UTSW 14 26429846 missense probably damaging 0.99
R7544:Slmap UTSW 14 26429848 missense probably damaging 0.99
R8112:Slmap UTSW 14 26422548 missense probably damaging 1.00
R8153:Slmap UTSW 14 26533333 missense probably benign
R8196:Slmap UTSW 14 26468491 missense probably damaging 1.00
R8300:Slmap UTSW 14 26418219 missense possibly damaging 0.62
R8523:Slmap UTSW 14 26429810 missense probably damaging 0.99
Z1177:Slmap UTSW 14 26533450 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATTGCAATTTCCACATAGCAAGCG -3'
(R):5'- ATGGCAGCTTGAACTCTTCC -3'

Sequencing Primer
(F):5'- GCAAGCGATATCTAAGTACAGATC -3'
(R):5'- ATGGCAGCTTGAACTCTTCCTATTAG -3'
Posted On2015-04-17