Incidental Mutation 'R3936:Rptn'
ID307164
Institutional Source Beutler Lab
Gene Symbol Rptn
Ensembl Gene ENSMUSG00000041984
Gene Namerepetin
Synonyms
Accession Numbers

Genbank: NM_009100; MGI: 1099055

Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R3936 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location93393699-93399442 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 93395576 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Proline at position 72 (H72P)
Ref Sequence ENSEMBL: ENSMUSP00000044998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045912]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045912
AA Change: H72P

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000044998
Gene: ENSMUSG00000041984
AA Change: H72P

DomainStartEndE-ValueType
Pfam:S_100 4 46 3.2e-13 PFAM
Blast:EFh 53 81 5e-10 BLAST
low complexity region 189 204 N/A INTRINSIC
low complexity region 237 252 N/A INTRINSIC
Blast:CTD 318 461 1e-7 BLAST
low complexity region 1007 1041 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191784
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195137
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 C T 12: 53,140,444 T1547M possibly damaging Het
Alk T A 17: 72,205,954 I337F probably damaging Het
Ank3 A T 10: 69,879,989 K491* probably null Het
Arx T A X: 93,297,369 L554Q probably damaging Het
Axdnd1 T C 1: 156,331,639 N203S probably benign Het
Baz2b A G 2: 59,912,761 V1622A possibly damaging Het
Btnl6 T A 17: 34,517,342 H4L probably benign Het
Dync2h1 C A 9: 7,001,482 L3835F probably damaging Het
Fcgbp T C 7: 28,075,399 F133L probably benign Het
Fnip1 A G 11: 54,480,239 probably null Het
G6pc A G 11: 101,374,603 I154V probably benign Het
Golgb1 G T 16: 36,914,056 E1222* probably null Het
Gpr85 A G 6: 13,836,045 F287L probably benign Het
Gzmk A T 13: 113,173,025 S164T probably damaging Het
Il22ra2 T A 10: 19,631,708 S156R probably benign Het
Kansl1 A T 11: 104,343,543 D712E possibly damaging Het
Mc3r T A 2: 172,249,296 I146N probably damaging Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mitf C T 6: 97,993,253 P54S probably damaging Het
Olfr156 T A 4: 43,821,359 M1L probably benign Het
P4hb A C 11: 120,562,409 H440Q probably benign Het
Pbsn T C X: 77,848,096 T32A probably damaging Het
Scn1a T C 2: 66,327,776 I418V probably damaging Het
Sf3a1 T A 11: 4,180,024 probably null Het
Slc35f1 C T 10: 53,108,218 T358I probably damaging Het
Slc9c1 A G 16: 45,606,830 probably benign Het
Sorcs3 T A 19: 48,713,504 V608D probably damaging Het
Sult2b1 C T 7: 45,742,216 V49M probably benign Het
Tlr11 A G 14: 50,362,735 E726G possibly damaging Het
Treh C T 9: 44,684,543 R342W probably benign Het
Other mutations in Rptn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Rptn APN 3 93397182 missense probably benign
IGL01070:Rptn APN 3 93398176 missense possibly damaging 0.86
IGL01625:Rptn APN 3 93397894 missense probably benign 0.18
IGL01678:Rptn APN 3 93396811 missense probably benign 0.00
IGL01716:Rptn APN 3 93396710 missense possibly damaging 0.53
IGL01767:Rptn APN 3 93395639 missense probably benign 0.00
IGL01872:Rptn APN 3 93396847 missense probably benign
IGL02000:Rptn APN 3 93396428 missense probably benign 0.01
IGL02066:Rptn APN 3 93397129 missense probably benign 0.01
IGL02090:Rptn APN 3 93396734 missense possibly damaging 0.85
IGL02116:Rptn APN 3 93395097 missense possibly damaging 0.88
IGL02216:Rptn APN 3 93395773 missense possibly damaging 0.73
IGL02368:Rptn APN 3 93397171 missense probably benign 0.18
IGL02820:Rptn APN 3 93396920 missense probably benign 0.01
IGL03323:Rptn APN 3 93397153 missense probably benign
IGL03404:Rptn APN 3 93398129 missense possibly damaging 0.53
D3080:Rptn UTSW 3 93395828 missense possibly damaging 0.85
H8786:Rptn UTSW 3 93397873 missense possibly damaging 0.53
IGL03097:Rptn UTSW 3 93397373 missense probably damaging 1.00
LCD18:Rptn UTSW 3 93397541 missense probably benign
PIT4431001:Rptn UTSW 3 93397397 small deletion probably benign
PIT4480001:Rptn UTSW 3 93397670 missense possibly damaging 0.85
R1024:Rptn UTSW 3 93398225 missense possibly damaging 0.72
R1119:Rptn UTSW 3 93396245 missense possibly damaging 0.96
R1727:Rptn UTSW 3 93397138 missense possibly damaging 0.73
R1901:Rptn UTSW 3 93396710 missense possibly damaging 0.53
R2247:Rptn UTSW 3 93396829 missense probably benign
R2921:Rptn UTSW 3 93398708 missense possibly damaging 0.96
R2922:Rptn UTSW 3 93398708 missense possibly damaging 0.96
R2923:Rptn UTSW 3 93398708 missense possibly damaging 0.96
R3901:Rptn UTSW 3 93398357 missense probably benign
R4304:Rptn UTSW 3 93396931 missense probably benign 0.33
R4491:Rptn UTSW 3 93396511 nonsense probably null
R4654:Rptn UTSW 3 93397485 missense possibly damaging 0.53
R4870:Rptn UTSW 3 93396469 nonsense probably null
R5246:Rptn UTSW 3 93396833 missense probably damaging 0.98
R5246:Rptn UTSW 3 93397729 missense possibly damaging 0.53
R5544:Rptn UTSW 3 93398473 missense possibly damaging 0.53
R5555:Rptn UTSW 3 93396701 missense probably benign
R5896:Rptn UTSW 3 93398332 nonsense probably null
R5956:Rptn UTSW 3 93398027 missense possibly damaging 0.53
R6192:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6209:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6224:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6226:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6227:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6230:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6247:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6258:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6393:Rptn UTSW 3 93397199 missense probably benign
R6513:Rptn UTSW 3 93396112 missense possibly damaging 0.73
R6854:Rptn UTSW 3 93398123 missense possibly damaging 0.53
R6855:Rptn UTSW 3 93398251 missense probably benign 0.33
R6884:Rptn UTSW 3 93395789 missense probably benign 0.33
R7018:Rptn UTSW 3 93397900 missense possibly damaging 0.73
R7241:Rptn UTSW 3 93395954 missense probably benign 0.01
R7337:Rptn UTSW 3 93396905 missense probably benign 0.03
R7754:Rptn UTSW 3 93395921 missense probably damaging 0.98
R7794:Rptn UTSW 3 93395729 missense probably benign
R7801:Rptn UTSW 3 93398224 missense possibly damaging 0.53
R8161:Rptn UTSW 3 93396693 small deletion probably benign
R8374:Rptn UTSW 3 93396295 nonsense probably null
X0018:Rptn UTSW 3 93395941 nonsense probably null
Z1088:Rptn UTSW 3 93397427 missense probably benign 0.01
Z1176:Rptn UTSW 3 93395018 missense probably benign 0.26
Z1177:Rptn UTSW 3 93395643 nonsense probably null
Z1177:Rptn UTSW 3 93395712 missense probably benign 0.01
Z1177:Rptn UTSW 3 93397887 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TTCAGAGAGCAAGCCATTTCAC -3'
(R):5'- CCTTCAGACTGATTGTGGTGAG -3'

Sequencing Primer
(F):5'- GAGAGCAAGCCATTTCACATTAATG -3'
(R):5'- TGAGAGTTCCGGCGTTCTCC -3'
Posted On2015-04-17