Incidental Mutation 'R3936:Olfr156'
List |< first << previous [record 20 of 31] next >> last >|
ID307166
Institutional Source Beutler Lab
Gene Symbol Olfr156
Ensembl Gene ENSMUSG00000110970
Gene Nameolfactory receptor 156
SynonymsGA_x6K02T2N78B-16125144-16126100, OR37B, Olfr37b, mOR37b, MOR262-6
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R3936 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location43820132-43823895 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to A at 43821359 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 1 (M1L)
Ref Sequence ENSEMBL: ENSMUSP00000148995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079234] [ENSMUST00000079465] [ENSMUST00000079465] [ENSMUST00000079465] [ENSMUST00000079465] [ENSMUST00000214843] [ENSMUST00000215406]
Predicted Effect probably benign
Transcript: ENSMUST00000079234
AA Change: M1L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000078226
Gene: ENSMUSG00000110970
AA Change: M1L

DomainStartEndE-ValueType
Pfam:7tm_4 31 314 4.8e-58 PFAM
Pfam:7tm_1 41 296 2.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079465
AA Change: M1L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000078431
Gene: ENSMUSG00000110970
AA Change: M1L

DomainStartEndE-ValueType
Pfam:7tm_4 31 314 1.2e-58 PFAM
Pfam:7tm_1 41 296 6.5e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079465
AA Change: M1L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000078431
Gene: ENSMUSG00000110970
AA Change: M1L

DomainStartEndE-ValueType
Pfam:7tm_4 31 314 1.2e-58 PFAM
Pfam:7tm_1 41 296 6.5e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079465
AA Change: M1L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000078431
Gene: ENSMUSG00000110970
AA Change: M1L

DomainStartEndE-ValueType
Pfam:7tm_4 31 314 1.2e-58 PFAM
Pfam:7tm_1 41 296 6.5e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079465
AA Change: M1L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000078431
Gene: ENSMUSG00000110970
AA Change: M1L

DomainStartEndE-ValueType
Pfam:7tm_4 31 314 1.2e-58 PFAM
Pfam:7tm_1 41 296 6.5e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214843
AA Change: M1L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000215406
AA Change: M1L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 C T 12: 53,140,444 T1547M possibly damaging Het
Alk T A 17: 72,205,954 I337F probably damaging Het
Ank3 A T 10: 69,879,989 K491* probably null Het
Arx T A X: 93,297,369 L554Q probably damaging Het
Axdnd1 T C 1: 156,331,639 N203S probably benign Het
Baz2b A G 2: 59,912,761 V1622A possibly damaging Het
Btnl6 T A 17: 34,517,342 H4L probably benign Het
Dync2h1 C A 9: 7,001,482 L3835F probably damaging Het
Fcgbp T C 7: 28,075,399 F133L probably benign Het
Fnip1 A G 11: 54,480,239 probably null Het
G6pc A G 11: 101,374,603 I154V probably benign Het
Golgb1 G T 16: 36,914,056 E1222* probably null Het
Gpr85 A G 6: 13,836,045 F287L probably benign Het
Gzmk A T 13: 113,173,025 S164T probably damaging Het
Il22ra2 T A 10: 19,631,708 S156R probably benign Het
Kansl1 A T 11: 104,343,543 D712E possibly damaging Het
Mc3r T A 2: 172,249,296 I146N probably damaging Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mitf C T 6: 97,993,253 P54S probably damaging Het
P4hb A C 11: 120,562,409 H440Q probably benign Het
Pbsn T C X: 77,848,096 T32A probably damaging Het
Rptn A C 3: 93,395,576 H72P possibly damaging Het
Scn1a T C 2: 66,327,776 I418V probably damaging Het
Sf3a1 T A 11: 4,180,024 probably null Het
Slc35f1 C T 10: 53,108,218 T358I probably damaging Het
Slc9c1 A G 16: 45,606,830 probably benign Het
Sorcs3 T A 19: 48,713,504 V608D probably damaging Het
Sult2b1 C T 7: 45,742,216 V49M probably benign Het
Tlr11 A G 14: 50,362,735 E726G possibly damaging Het
Treh C T 9: 44,684,543 R342W probably benign Het
Other mutations in Olfr156
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02508:Olfr156 APN 4 43821289 missense possibly damaging 0.83
IGL02690:Olfr156 APN 4 43821190 missense possibly damaging 0.50
R1454:Olfr156 UTSW 4 43820639 missense probably damaging 1.00
R1465:Olfr156 UTSW 4 43820723 missense probably benign 0.00
R1465:Olfr156 UTSW 4 43820723 missense probably benign 0.00
R1859:Olfr156 UTSW 4 43820779 missense possibly damaging 0.91
R2146:Olfr156 UTSW 4 43821178 missense probably damaging 1.00
R3160:Olfr156 UTSW 4 43820544 missense probably benign 0.04
R3162:Olfr156 UTSW 4 43820544 missense probably benign 0.04
R3162:Olfr156 UTSW 4 43820544 missense probably benign 0.04
R3414:Olfr156 UTSW 4 43821258 missense probably benign 0.00
R4497:Olfr156 UTSW 4 43821175 missense probably damaging 1.00
R4631:Olfr156 UTSW 4 43820563 missense probably benign 0.08
R5125:Olfr156 UTSW 4 43820480 missense probably benign 0.15
R5371:Olfr156 UTSW 4 43821058 missense probably damaging 1.00
R5698:Olfr156 UTSW 4 43821183 missense probably damaging 1.00
R5807:Olfr156 UTSW 4 43820912 missense probably benign 0.00
R5889:Olfr156 UTSW 4 43820492 missense possibly damaging 0.89
R6461:Olfr156 UTSW 4 43821355 missense probably benign
R6865:Olfr156 UTSW 4 43821346 missense probably benign 0.00
R7566:Olfr156 UTSW 4 43820711 missense probably damaging 1.00
R7908:Olfr156 UTSW 4 43821086 missense probably damaging 1.00
Z1177:Olfr156 UTSW 4 43820900 missense possibly damaging 0.90
Z1177:Olfr156 UTSW 4 43821337 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGTACATGGGCGTGTGCAG -3'
(R):5'- TGGCCTGACTATATCGCGTC -3'

Sequencing Primer
(F):5'- GGTGGGAGTCGAGGATGCTC -3'
(R):5'- ATCTATCTCAGTTGGCTACCAGAGG -3'
Posted On2015-04-17