Incidental Mutation 'R3936:Gpr85'
ID 307168
Institutional Source Beutler Lab
Gene Symbol Gpr85
Ensembl Gene ENSMUSG00000048216
Gene Name G protein-coupled receptor 85
Synonyms
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.260) question?
Stock # R3936 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 13834458-13839942 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 13836045 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 287 (F287L)
Ref Sequence ENSEMBL: ENSMUSP00000111155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060442] [ENSMUST00000115491] [ENSMUST00000115492]
AlphaFold P60894
Predicted Effect probably benign
Transcript: ENSMUST00000060442
AA Change: F287L

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000053837
Gene: ENSMUSG00000048216
AA Change: F287L

DomainStartEndE-ValueType
Pfam:7tm_1 37 338 4.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115491
AA Change: F287L

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000111154
Gene: ENSMUSG00000048216
AA Change: F287L

DomainStartEndE-ValueType
Pfam:7tm_1 37 338 4.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115492
AA Change: F287L

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000111155
Gene: ENSMUSG00000048216
AA Change: F287L

DomainStartEndE-ValueType
Pfam:7tm_1 37 338 1.6e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127072
Meta Mutation Damage Score 0.1429 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the G protein-coupled receptor (GPCR) family, such as GPR85, have a similar structure characterized by 7 transmembrane domains. Activation of GPCRs by extracellular stimuli, such as neurotransmitters, hormones, or light, induces an intracellular signaling cascade mediated by heterotrimeric GTP-binding proteins, or G proteins (Matsumoto et al., 2000 [PubMed 10833454]).[supplied by OMIM, Aug 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display a significant increase in brain weight and enhanced contextual memory in a fear-conditioning task but no additional behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 C T 12: 53,140,444 T1547M possibly damaging Het
Alk T A 17: 72,205,954 I337F probably damaging Het
Ank3 A T 10: 69,879,989 K491* probably null Het
Arx T A X: 93,297,369 L554Q probably damaging Het
Axdnd1 T C 1: 156,331,639 N203S probably benign Het
Baz2b A G 2: 59,912,761 V1622A possibly damaging Het
Btnl6 T A 17: 34,517,342 H4L probably benign Het
Dync2h1 C A 9: 7,001,482 L3835F probably damaging Het
Fcgbp T C 7: 28,075,399 F133L probably benign Het
Fnip1 A G 11: 54,480,239 probably null Het
G6pc A G 11: 101,374,603 I154V probably benign Het
Golgb1 G T 16: 36,914,056 E1222* probably null Het
Gzmk A T 13: 113,173,025 S164T probably damaging Het
Il22ra2 T A 10: 19,631,708 S156R probably benign Het
Kansl1 A T 11: 104,343,543 D712E possibly damaging Het
Mc3r T A 2: 172,249,296 I146N probably damaging Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mitf C T 6: 97,993,253 P54S probably damaging Het
Olfr156 T A 4: 43,821,359 M1L probably benign Het
P4hb A C 11: 120,562,409 H440Q probably benign Het
Pbsn T C X: 77,848,096 T32A probably damaging Het
Rptn A C 3: 93,395,576 H72P possibly damaging Het
Scn1a T C 2: 66,327,776 I418V probably damaging Het
Sf3a1 T A 11: 4,180,024 probably null Het
Slc35f1 C T 10: 53,108,218 T358I probably damaging Het
Slc9c1 A G 16: 45,606,830 probably benign Het
Sorcs3 T A 19: 48,713,504 V608D probably damaging Het
Sult2b1 C T 7: 45,742,216 V49M probably benign Het
Tlr11 A G 14: 50,362,735 E726G possibly damaging Het
Treh C T 9: 44,684,543 R342W probably benign Het
Other mutations in Gpr85
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02414:Gpr85 APN 6 13836910 utr 5 prime probably benign
R0784:Gpr85 UTSW 6 13836749 missense probably benign 0.25
R1356:Gpr85 UTSW 6 13836147 missense probably benign 0.42
R2343:Gpr85 UTSW 6 13836696 missense probably damaging 1.00
R3934:Gpr85 UTSW 6 13836045 missense probably benign 0.02
R3935:Gpr85 UTSW 6 13836045 missense probably benign 0.02
R4925:Gpr85 UTSW 6 13835978 missense probably benign 0.26
R5313:Gpr85 UTSW 6 13836302 missense probably damaging 1.00
R5586:Gpr85 UTSW 6 13836001 nonsense probably null
R7043:Gpr85 UTSW 6 13835877 missense probably damaging 1.00
R8458:Gpr85 UTSW 6 13836849 missense probably benign
R8468:Gpr85 UTSW 6 13836296 missense probably damaging 1.00
R8503:Gpr85 UTSW 6 13836830 missense probably benign 0.01
R9519:Gpr85 UTSW 6 13836999 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CTGCAGTAAAGAAGGGTTGTGC -3'
(R):5'- GTCAGAACTGGACCTTTCATGG -3'

Sequencing Primer
(F):5'- TGAAACAGCGCCTCAGC -3'
(R):5'- CTTTCATGGCCCTGGAGCTAG -3'
Posted On 2015-04-17