Mutagenetix > Incidental Mutation

Incidental Mutation 'R3936:Fnip1'

307179

Institutional Source

Beutler Lab

Gene Symbol

Fnip1

Ensembl Gene

ENSMUSG00000035992

Gene Name

folliculin interacting protein 1

Synonyms

A730024A03Rik

Accession Numbers

Ncbi RefSeq: NM_173753.4; MGI:2444668

Essential gene?

Possibly essential (E-score: 0.651) question?

Stock #

R3936 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

54438199-54518235 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 54480239 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000121399 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046835] [ENSMUST00000046835] [ENSMUST00000143650] [ENSMUST00000143650]

AlphaFold

Q68FD7

Predicted Effect

probably null
Transcript: ENSMUST00000046835

SMART Domains

Protein: ENSMUSP00000049026
Gene: ENSMUSG00000035992

Domain	Start	End	E-Value	Type
Pfam:FNIP_N	41	159	1.7e-29	PFAM
Pfam:FNIP_M	316	549	9.9e-92	PFAM
Pfam:FNIP_C	975	1161	7.6e-73	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000046835

SMART Domains

Protein: ENSMUSP00000049026
Gene: ENSMUSG00000035992

Domain	Start	End	E-Value	Type
Pfam:FNIP_N	41	159	1.7e-29	PFAM
Pfam:FNIP_M	316	549	9.9e-92	PFAM
Pfam:FNIP_C	975	1161	7.6e-73	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000143650

SMART Domains

Protein: ENSMUSP00000121399
Gene: ENSMUSG00000035992

Domain	Start	End	E-Value	Type
Pfam:FNIP_N	17	139	3.9e-36	PFAM
Pfam:FNIP_M	288	526	5.1e-87	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000143650

SMART Domains

Protein: ENSMUSP00000121399
Gene: ENSMUSG00000035992

Domain	Start	End	E-Value	Type
Pfam:FNIP_N	17	139	3.9e-36	PFAM
Pfam:FNIP_M	288	526	5.1e-87	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the folliculin-interacting protein family. The encoded protein binds to the tumor suppressor folliculin and to AMP-activated protein kinase (AMPK) and be involved in cellular metabolism and nutrient sensing by regulating the AMPK-mechanistic target of rapamycin signaling pathway. A homologous binding partner of this protein, folliculin-interacting protein 2, has similar binding activities and may suggest functional redundancy within this protein family. Both folliculin-interacting proteins have also been shown to bind the molecular chaperone heat shock protein-90 (Hsp90) and they may function as a co-chaperones in the stabilization of tumor suppressor folliculin which is a target of Hsp90 chaperone activity. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for an ENU-induced or targeted allele exhibit arrested B cell development at the pre-B cell stage with increased B cell apoptosis. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted(1) Gene trapped(2)

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap6	C	T	12: 53,140,444	T1547M	possibly damaging	Het
Alk	T	A	17: 72,205,954	I337F	probably damaging	Het
Ank3	A	T	10: 69,879,989	K491*	probably null	Het
Arx	T	A	X: 93,297,369	L554Q	probably damaging	Het
Axdnd1	T	C	1: 156,331,639	N203S	probably benign	Het
Baz2b	A	G	2: 59,912,761	V1622A	possibly damaging	Het
Btnl6	T	A	17: 34,517,342	H4L	probably benign	Het
Dync2h1	C	A	9: 7,001,482	L3835F	probably damaging	Het
Fcgbp	T	C	7: 28,075,399	F133L	probably benign	Het
G6pc	A	G	11: 101,374,603	I154V	probably benign	Het
Golgb1	G	T	16: 36,914,056	E1222*	probably null	Het
Gpr85	A	G	6: 13,836,045	F287L	probably benign	Het
Gzmk	A	T	13: 113,173,025	S164T	probably damaging	Het
Il22ra2	T	A	10: 19,631,708	S156R	probably benign	Het
Kansl1	A	T	11: 104,343,543	D712E	possibly damaging	Het
Mc3r	T	A	2: 172,249,296	I146N	probably damaging	Het
Mcm2	G	A	6: 88,893,008	R60C	probably damaging	Het
Mitf	C	T	6: 97,993,253	P54S	probably damaging	Het
Olfr156	T	A	4: 43,821,359	M1L	probably benign	Het
P4hb	A	C	11: 120,562,409	H440Q	probably benign	Het
Pbsn	T	C	X: 77,848,096	T32A	probably damaging	Het
Rptn	A	C	3: 93,395,576	H72P	possibly damaging	Het
Scn1a	T	C	2: 66,327,776	I418V	probably damaging	Het
Sf3a1	T	A	11: 4,180,024		probably null	Het
Slc35f1	C	T	10: 53,108,218	T358I	probably damaging	Het
Slc9c1	A	G	16: 45,606,830		probably benign	Het
Sorcs3	T	A	19: 48,713,504	V608D	probably damaging	Het
Sult2b1	C	T	7: 45,742,216	V49M	probably benign	Het
Tlr11	A	G	14: 50,362,735	E726G	possibly damaging	Het
Treh	C	T	9: 44,684,543	R342W	probably benign	Het

Other mutations in Fnip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01449:Fnip1	APN	11	54499508	missense	probably damaging	1.00
IGL01590:Fnip1	APN	11	54493300	missense	probably damaging	1.00
IGL01959:Fnip1	APN	11	54490912	missense	possibly damaging	0.95
IGL02157:Fnip1	APN	11	54487763	missense	probably damaging	1.00
IGL02197:Fnip1	APN	11	54493374	missense	probably damaging	1.00
IGL02476:Fnip1	APN	11	54499567	splice site	probably benign
IGL02639:Fnip1	APN	11	54475640	nonsense	probably null
IGL02742:Fnip1	APN	11	54493351	missense	probably damaging	1.00
hamel	UTSW	11	54480685	critical splice donor site	probably benign
hamel2	UTSW	11	54502271	missense	probably damaging	1.00
Normandy	UTSW	11	54493181	splice site	probably benign
H8562:Fnip1	UTSW	11	54480297	missense	probably damaging	0.98
P0043:Fnip1	UTSW	11	54503225	missense	probably benign	0.00
R0114:Fnip1	UTSW	11	54487801	splice site	probably benign
R0278:Fnip1	UTSW	11	54489343	splice site	probably null
R0409:Fnip1	UTSW	11	54480354	splice site	probably null
R0840:Fnip1	UTSW	11	54493181	splice site	probably benign
R1131:Fnip1	UTSW	11	54493303	missense	possibly damaging	0.82
R1205:Fnip1	UTSW	11	54502306	missense	possibly damaging	0.91
R1271:Fnip1	UTSW	11	54503297	missense	probably benign
R1817:Fnip1	UTSW	11	54502453	missense	probably benign	0.30
R1826:Fnip1	UTSW	11	54466164	missense	probably damaging	1.00
R1872:Fnip1	UTSW	11	54487735	missense	probably damaging	1.00
R1883:Fnip1	UTSW	11	54515547	missense	probably damaging	1.00
R1917:Fnip1	UTSW	11	54480684	missense	probably damaging	0.99
R1918:Fnip1	UTSW	11	54480684	missense	probably damaging	0.99
R1919:Fnip1	UTSW	11	54480684	missense	probably damaging	0.99
R2010:Fnip1	UTSW	11	54482503	missense	probably damaging	1.00
R2117:Fnip1	UTSW	11	54500624	missense	probably damaging	1.00
R2329:Fnip1	UTSW	11	54466107	missense	probably damaging	0.98
R2337:Fnip1	UTSW	11	54475737	missense	probably damaging	0.98
R2850:Fnip1	UTSW	11	54502677	missense	probably benign	0.32
R2863:Fnip1	UTSW	11	54502424	missense	probably damaging	1.00
R2864:Fnip1	UTSW	11	54502424	missense	probably damaging	1.00
R2865:Fnip1	UTSW	11	54502424	missense	probably damaging	1.00
R4017:Fnip1	UTSW	11	54509987	missense	probably benign	0.14
R4033:Fnip1	UTSW	11	54502471	missense	probably benign	0.02
R4668:Fnip1	UTSW	11	54503559	missense	probably damaging	1.00
R4695:Fnip1	UTSW	11	54499419	missense	probably damaging	1.00
R4762:Fnip1	UTSW	11	54466171	missense	probably damaging	1.00
R4762:Fnip1	UTSW	11	54499526	missense	probably benign	0.01
R4777:Fnip1	UTSW	11	54500556	missense	probably damaging	1.00
R4863:Fnip1	UTSW	11	54515556	missense	possibly damaging	0.52
R5369:Fnip1	UTSW	11	54502589	missense	probably benign
R5481:Fnip1	UTSW	11	54502644	missense	probably benign	0.01
R5562:Fnip1	UTSW	11	54489342	critical splice donor site	probably null
R5563:Fnip1	UTSW	11	54504862	missense	probably benign	0.05
R5628:Fnip1	UTSW	11	54503633	missense	probably benign	0.08
R5689:Fnip1	UTSW	11	54502289	missense	probably damaging	1.00
R6009:Fnip1	UTSW	11	54502271	missense	probably damaging	1.00
R6120:Fnip1	UTSW	11	54510000	missense	probably benign	0.23
R6429:Fnip1	UTSW	11	54515567	missense	probably damaging	1.00
R6546:Fnip1	UTSW	11	54502611	missense	probably benign	0.03
R6600:Fnip1	UTSW	11	54503099	missense	probably benign
R6882:Fnip1	UTSW	11	54509898	missense	probably damaging	1.00
R6966:Fnip1	UTSW	11	54482559	missense	probably benign	0.00
R7009:Fnip1	UTSW	11	54502935	missense	probably damaging	1.00
R7664:Fnip1	UTSW	11	54466125	missense	probably damaging	1.00
R7706:Fnip1	UTSW	11	54515499	missense	probably benign	0.41
R7866:Fnip1	UTSW	11	54465402	start gained	probably benign
R7939:Fnip1	UTSW	11	54502267	missense	probably damaging	1.00
R7943:Fnip1	UTSW	11	54502388	missense	probably damaging	1.00
R8429:Fnip1	UTSW	11	54475696	missense	possibly damaging	0.94
R8546:Fnip1	UTSW	11	54510000	missense	probably benign	0.23
R8753:Fnip1	UTSW	11	54510041	missense	probably damaging	0.99
R8834:Fnip1	UTSW	11	54504755	missense	possibly damaging	0.83
R8875:Fnip1	UTSW	11	54515554	missense	probably damaging	1.00
R9605:Fnip1	UTSW	11	54490887	missense	probably benign	0.02
R9735:Fnip1	UTSW	11	54503447	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- ACTTGAGATATTCCTGCCTTAGTC -3'
(R):5'- AAGCTGGGATCTGACAAGCTC -3'

Sequencing Primer
(F):5'- GCCTTAGTCTTCTCACTGTTAGG -3'
(R):5'- GGATCTGACAAGCTCAGTCTG -3'

Posted On

2015-04-17