Incidental Mutation 'R3936:P4hb'
ID307183
Institutional Source Beutler Lab
Gene Symbol P4hb
Ensembl Gene ENSMUSG00000025130
Gene Nameprolyl 4-hydroxylase, beta polypeptide
SynonymsThbp, protein disulfide isomerase, ERp59, PDI, Pdia1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.375) question?
Stock #R3936 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location120560298-120573253 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 120562409 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 440 (H440Q)
Ref Sequence ENSEMBL: ENSMUSP00000026122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026122] [ENSMUST00000168360]
Predicted Effect probably benign
Transcript: ENSMUST00000026122
AA Change: H440Q

PolyPhen 2 Score 0.203 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000026122
Gene: ENSMUSG00000025130
AA Change: H440Q

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Thioredoxin 27 134 4.9e-37 PFAM
Pfam:Thioredoxin_2 39 126 3.5e-9 PFAM
Pfam:Thioredoxin_6 163 347 8.3e-44 PFAM
Pfam:Thioredoxin 370 475 1.5e-30 PFAM
low complexity region 478 501 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166620
Predicted Effect probably benign
Transcript: ENSMUST00000168360
AA Change: H96Q

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000128796
Gene: ENSMUSG00000025130
AA Change: H96Q

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Thioredoxin 27 131 6e-32 PFAM
low complexity region 134 157 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the beta subunit of prolyl 4-hydroxylase, a highly abundant multifunctional enzyme that belongs to the protein disulfide isomerase family. When present as a tetramer consisting of two alpha and two beta subunits, this enzyme is involved in hydroxylation of prolyl residues in preprocollagen. This enzyme is also a disulfide isomerase containing two thioredoxin domains that catalyze the formation, breakage and rearrangement of disulfide bonds. Other known functions include its ability to act as a chaperone that inhibits aggregation of misfolded proteins in a concentration-dependent manner, its ability to bind thyroid hormone, its role in both the influx and efflux of S-nitrosothiol-bound nitric oxide, and its function as a subunit of the microsomal triglyceride transfer protein complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for a knock-out allele and conditional allele activated in immune cells exhibit impaired neutrophil recruitment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 C T 12: 53,140,444 T1547M possibly damaging Het
Alk T A 17: 72,205,954 I337F probably damaging Het
Ank3 A T 10: 69,879,989 K491* probably null Het
Arx T A X: 93,297,369 L554Q probably damaging Het
Axdnd1 T C 1: 156,331,639 N203S probably benign Het
Baz2b A G 2: 59,912,761 V1622A possibly damaging Het
Btnl6 T A 17: 34,517,342 H4L probably benign Het
Dync2h1 C A 9: 7,001,482 L3835F probably damaging Het
Fcgbp T C 7: 28,075,399 F133L probably benign Het
Fnip1 A G 11: 54,480,239 probably null Het
G6pc A G 11: 101,374,603 I154V probably benign Het
Golgb1 G T 16: 36,914,056 E1222* probably null Het
Gpr85 A G 6: 13,836,045 F287L probably benign Het
Gzmk A T 13: 113,173,025 S164T probably damaging Het
Il22ra2 T A 10: 19,631,708 S156R probably benign Het
Kansl1 A T 11: 104,343,543 D712E possibly damaging Het
Mc3r T A 2: 172,249,296 I146N probably damaging Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mitf C T 6: 97,993,253 P54S probably damaging Het
Olfr156 T A 4: 43,821,359 M1L probably benign Het
Pbsn T C X: 77,848,096 T32A probably damaging Het
Rptn A C 3: 93,395,576 H72P possibly damaging Het
Scn1a T C 2: 66,327,776 I418V probably damaging Het
Sf3a1 T A 11: 4,180,024 probably null Het
Slc35f1 C T 10: 53,108,218 T358I probably damaging Het
Slc9c1 A G 16: 45,606,830 probably benign Het
Sorcs3 T A 19: 48,713,504 V608D probably damaging Het
Sult2b1 C T 7: 45,742,216 V49M probably benign Het
Tlr11 A G 14: 50,362,735 E726G possibly damaging Het
Treh C T 9: 44,684,543 R342W probably benign Het
Other mutations in P4hb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:P4hb APN 11 120563818 missense probably benign 0.00
R0042:P4hb UTSW 11 120568266 missense probably damaging 1.00
R0042:P4hb UTSW 11 120568266 missense probably damaging 1.00
R0362:P4hb UTSW 11 120563336 missense probably benign 0.04
R0597:P4hb UTSW 11 120568244 missense possibly damaging 0.53
R1458:P4hb UTSW 11 120562555 splice site probably benign
R1635:P4hb UTSW 11 120571616 missense probably damaging 0.97
R1750:P4hb UTSW 11 120562720 missense probably damaging 0.99
R1773:P4hb UTSW 11 120572726 missense probably damaging 1.00
R1856:P4hb UTSW 11 120563218 missense probably benign 0.23
R1874:P4hb UTSW 11 120562166 missense probably benign
R2014:P4hb UTSW 11 120562696 missense probably damaging 0.98
R2239:P4hb UTSW 11 120563282 missense probably damaging 1.00
R2331:P4hb UTSW 11 120568280 missense probably benign 0.00
R3935:P4hb UTSW 11 120562409 missense probably benign 0.20
R5601:P4hb UTSW 11 120571615 missense possibly damaging 0.90
R5893:P4hb UTSW 11 120571650 missense probably damaging 1.00
R6533:P4hb UTSW 11 120571643 missense probably damaging 1.00
R8243:P4hb UTSW 11 120563380 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCTTAAAACCGTCCAGTGTCCG -3'
(R):5'- AACCTCAAACGTCGGTGGTG -3'

Sequencing Primer
(F):5'- GCTCGCCGTTGTAATCAATGAC -3'
(R):5'- TGGTGGCTCTGTCCAGGAC -3'
Posted On2015-04-17