Incidental Mutation 'R3936:Gzmk'
List |< first << previous [record 14 of 31] next >> last >|
ID307186
Institutional Source Beutler Lab
Gene Symbol Gzmk
Ensembl Gene ENSMUSG00000042385
Gene Namegranzyme K
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3936 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location113171608-113225908 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 113173025 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 164 (S164T)
Ref Sequence ENSEMBL: ENSMUSP00000044512 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038212] [ENSMUST00000122399] [ENSMUST00000140324]
Predicted Effect probably damaging
Transcript: ENSMUST00000038212
AA Change: S164T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044512
Gene: ENSMUSG00000042385
AA Change: S164T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Tryp_SPc 25 253 2.12e-87 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122399
AA Change: S125T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113530
Gene: ENSMUSG00000042385
AA Change: S125T

DomainStartEndE-ValueType
Tryp_SPc 1 214 9.28e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140324
SMART Domains Protein: ENSMUSP00000114250
Gene: ENSMUSG00000042385

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Trypsin 26 69 1.2e-18 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a member of a group of related serine proteases from the cytoplasmic granules of cytotoxic lymphocytes. Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the remarkable ability to recognize, bind, and lyse specific target cells. They are thought to protect their host by lysing cells bearing on their surface 'nonself' antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein described here lacks consensus sequences for N-glycosylation present in other granzymes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 C T 12: 53,140,444 T1547M possibly damaging Het
Alk T A 17: 72,205,954 I337F probably damaging Het
Ank3 A T 10: 69,879,989 K491* probably null Het
Arx T A X: 93,297,369 L554Q probably damaging Het
Axdnd1 T C 1: 156,331,639 N203S probably benign Het
Baz2b A G 2: 59,912,761 V1622A possibly damaging Het
Btnl6 T A 17: 34,517,342 H4L probably benign Het
Dync2h1 C A 9: 7,001,482 L3835F probably damaging Het
Fcgbp T C 7: 28,075,399 F133L probably benign Het
Fnip1 A G 11: 54,480,239 probably null Het
G6pc A G 11: 101,374,603 I154V probably benign Het
Golgb1 G T 16: 36,914,056 E1222* probably null Het
Gpr85 A G 6: 13,836,045 F287L probably benign Het
Il22ra2 T A 10: 19,631,708 S156R probably benign Het
Kansl1 A T 11: 104,343,543 D712E possibly damaging Het
Mc3r T A 2: 172,249,296 I146N probably damaging Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mitf C T 6: 97,993,253 P54S probably damaging Het
Olfr156 T A 4: 43,821,359 M1L probably benign Het
P4hb A C 11: 120,562,409 H440Q probably benign Het
Pbsn T C X: 77,848,096 T32A probably damaging Het
Rptn A C 3: 93,395,576 H72P possibly damaging Het
Scn1a T C 2: 66,327,776 I418V probably damaging Het
Sf3a1 T A 11: 4,180,024 probably null Het
Slc35f1 C T 10: 53,108,218 T358I probably damaging Het
Slc9c1 A G 16: 45,606,830 probably benign Het
Sorcs3 T A 19: 48,713,504 V608D probably damaging Het
Sult2b1 C T 7: 45,742,216 V49M probably benign Het
Tlr11 A G 14: 50,362,735 E726G possibly damaging Het
Treh C T 9: 44,684,543 R342W probably benign Het
Other mutations in Gzmk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00563:Gzmk APN 13 113173124 missense probably benign 0.09
IGL01702:Gzmk APN 13 113180550 missense probably damaging 1.00
IGL02869:Gzmk APN 13 113172026 missense probably damaging 1.00
R1687:Gzmk UTSW 13 113173928 missense probably benign 0.32
R1813:Gzmk UTSW 13 113172893 missense probably damaging 1.00
R1896:Gzmk UTSW 13 113172893 missense probably damaging 1.00
R2113:Gzmk UTSW 13 113173955 missense probably benign 0.33
R2128:Gzmk UTSW 13 113172014 missense probably damaging 0.99
R2993:Gzmk UTSW 13 113180477 missense probably damaging 1.00
R4619:Gzmk UTSW 13 113173123 missense probably damaging 0.99
R4838:Gzmk UTSW 13 113173021 missense probably damaging 1.00
R5131:Gzmk UTSW 13 113173948 missense probably benign
R5892:Gzmk UTSW 13 113173922 critical splice donor site probably null
R6582:Gzmk UTSW 13 113180511 missense probably damaging 1.00
R7491:Gzmk UTSW 13 113172001 missense probably benign 0.36
R8027:Gzmk UTSW 13 113171900 nonsense probably null
R8145:Gzmk UTSW 13 113171896 missense probably damaging 1.00
X0025:Gzmk UTSW 13 113180833 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCCTAGAGGAGATGCTGTGG -3'
(R):5'- CAATGCACAGTCAAGTGAGG -3'

Sequencing Primer
(F):5'- GAGTTGGCTTTCAAATATGAGAACC -3'
(R):5'- CTTCACCTGGGATCCAAAA -3'
Posted On2015-04-17