Incidental Mutation 'R3936:Slc9c1'
ID307189
Institutional Source Beutler Lab
Gene Symbol Slc9c1
Ensembl Gene ENSMUSG00000033210
Gene Namesolute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
SynonymsLOC208169, Slc9a10, spermNHE
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.601) question?
Stock #R3936 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location45535309-45607001 bp(+) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) A to G at 45606830 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000023339] [ENSMUST00000159945] [ENSMUST00000161347]
Predicted Effect probably benign
Transcript: ENSMUST00000023339
Predicted Effect unknown
Transcript: ENSMUST00000159945
AA Change: E1166G
SMART Domains Protein: ENSMUSP00000124969
Gene: ENSMUSG00000033210
AA Change: E1166G

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 40 445 2.3e-31 PFAM
low complexity region 588 602 N/A INTRINSIC
transmembrane domain 635 654 N/A INTRINSIC
transmembrane domain 669 686 N/A INTRINSIC
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
cNMP 890 1026 4.99e-1 SMART
low complexity region 1161 1175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161347
Predicted Effect probably benign
Transcript: ENSMUST00000162151
Predicted Effect probably benign
Transcript: ENSMUST00000162774
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC9A10 is a member of the sodium-hydrogen exchanger (NHE) family (see SLC9A1, MIM 107310) and is required for male fertility and sperm motility (Wang et al., 2003 [PubMed 14634667]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Homozygous null mice display male infertility and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 C T 12: 53,140,444 T1547M possibly damaging Het
Alk T A 17: 72,205,954 I337F probably damaging Het
Ank3 A T 10: 69,879,989 K491* probably null Het
Arx T A X: 93,297,369 L554Q probably damaging Het
Axdnd1 T C 1: 156,331,639 N203S probably benign Het
Baz2b A G 2: 59,912,761 V1622A possibly damaging Het
Btnl6 T A 17: 34,517,342 H4L probably benign Het
Dync2h1 C A 9: 7,001,482 L3835F probably damaging Het
Fcgbp T C 7: 28,075,399 F133L probably benign Het
Fnip1 A G 11: 54,480,239 probably null Het
G6pc A G 11: 101,374,603 I154V probably benign Het
Golgb1 G T 16: 36,914,056 E1222* probably null Het
Gpr85 A G 6: 13,836,045 F287L probably benign Het
Gzmk A T 13: 113,173,025 S164T probably damaging Het
Il22ra2 T A 10: 19,631,708 S156R probably benign Het
Kansl1 A T 11: 104,343,543 D712E possibly damaging Het
Mc3r T A 2: 172,249,296 I146N probably damaging Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mitf C T 6: 97,993,253 P54S probably damaging Het
Olfr156 T A 4: 43,821,359 M1L probably benign Het
P4hb A C 11: 120,562,409 H440Q probably benign Het
Pbsn T C X: 77,848,096 T32A probably damaging Het
Rptn A C 3: 93,395,576 H72P possibly damaging Het
Scn1a T C 2: 66,327,776 I418V probably damaging Het
Sf3a1 T A 11: 4,180,024 probably null Het
Slc35f1 C T 10: 53,108,218 T358I probably damaging Het
Sorcs3 T A 19: 48,713,504 V608D probably damaging Het
Sult2b1 C T 7: 45,742,216 V49M probably benign Het
Tlr11 A G 14: 50,362,735 E726G possibly damaging Het
Treh C T 9: 44,684,543 R342W probably benign Het
Other mutations in Slc9c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc9c1 APN 16 45573389 missense possibly damaging 0.93
IGL00510:Slc9c1 APN 16 45539639 missense probably benign 0.00
IGL00949:Slc9c1 APN 16 45593358 missense probably benign
IGL01287:Slc9c1 APN 16 45584448 nonsense probably null
IGL01536:Slc9c1 APN 16 45589629 critical splice donor site probably null
IGL01655:Slc9c1 APN 16 45582972 missense probably benign
IGL01671:Slc9c1 APN 16 45560315 missense probably benign
IGL01720:Slc9c1 APN 16 45555769 missense probably damaging 1.00
IGL01758:Slc9c1 APN 16 45541461 missense probably damaging 1.00
IGL02031:Slc9c1 APN 16 45599470 missense probably benign 0.00
IGL02321:Slc9c1 APN 16 45556614 missense probably benign 0.02
IGL02472:Slc9c1 APN 16 45580142 missense probably benign 0.10
IGL02516:Slc9c1 APN 16 45577875 missense probably damaging 0.96
IGL02732:Slc9c1 APN 16 45550185 missense possibly damaging 0.78
IGL02741:Slc9c1 APN 16 45581598 missense possibly damaging 0.48
IGL02795:Slc9c1 APN 16 45575419 missense probably benign 0.06
IGL03032:Slc9c1 APN 16 45543261 splice site probably benign
IGL03062:Slc9c1 APN 16 45599758 missense probably benign 0.20
IGL03184:Slc9c1 APN 16 45547640 missense probably damaging 1.00
IGL03351:Slc9c1 APN 16 45543168 missense probably benign 0.01
P0041:Slc9c1 UTSW 16 45550161 missense possibly damaging 0.65
R0052:Slc9c1 UTSW 16 45606856 utr 3 prime probably benign
R0107:Slc9c1 UTSW 16 45575420 missense probably benign 0.00
R0255:Slc9c1 UTSW 16 45554300 missense probably benign 0.25
R0316:Slc9c1 UTSW 16 45580232 missense possibly damaging 0.72
R0437:Slc9c1 UTSW 16 45599887 splice site probably benign
R0611:Slc9c1 UTSW 16 45581602 missense possibly damaging 0.83
R0624:Slc9c1 UTSW 16 45573356 missense probably benign 0.00
R0630:Slc9c1 UTSW 16 45543120 splice site probably benign
R1106:Slc9c1 UTSW 16 45555807 missense possibly damaging 0.66
R1396:Slc9c1 UTSW 16 45573347 missense probably benign 0.43
R1727:Slc9c1 UTSW 16 45601961 missense probably benign 0.27
R1732:Slc9c1 UTSW 16 45552928 missense probably benign 0.21
R1754:Slc9c1 UTSW 16 45589509 missense probably benign 0.11
R1799:Slc9c1 UTSW 16 45554289 missense probably damaging 1.00
R1802:Slc9c1 UTSW 16 45558281 missense probably benign
R1813:Slc9c1 UTSW 16 45573347 missense probably benign 0.43
R1972:Slc9c1 UTSW 16 45593472 missense possibly damaging 0.89
R1985:Slc9c1 UTSW 16 45550106 missense probably benign 0.01
R1995:Slc9c1 UTSW 16 45554255 missense probably damaging 0.99
R2045:Slc9c1 UTSW 16 45580250 missense probably damaging 1.00
R2146:Slc9c1 UTSW 16 45593464 missense probably benign 0.19
R2511:Slc9c1 UTSW 16 45544736 missense possibly damaging 0.79
R3716:Slc9c1 UTSW 16 45580219 missense probably benign
R3765:Slc9c1 UTSW 16 45590881 missense possibly damaging 0.89
R4051:Slc9c1 UTSW 16 45543230 missense probably damaging 1.00
R4302:Slc9c1 UTSW 16 45544791 missense probably benign 0.35
R4433:Slc9c1 UTSW 16 45599466 missense possibly damaging 0.93
R4651:Slc9c1 UTSW 16 45547393 makesense probably null
R4928:Slc9c1 UTSW 16 45575409 missense probably benign 0.42
R4957:Slc9c1 UTSW 16 45544831 missense probably benign 0.45
R4989:Slc9c1 UTSW 16 45593437 missense probably benign 0.03
R5478:Slc9c1 UTSW 16 45554246 missense probably damaging 1.00
R5534:Slc9c1 UTSW 16 45556614 missense probably benign 0.00
R5898:Slc9c1 UTSW 16 45544760 missense probably damaging 1.00
R5939:Slc9c1 UTSW 16 45547668 missense probably benign 0.00
R6110:Slc9c1 UTSW 16 45575368 missense probably damaging 1.00
R6115:Slc9c1 UTSW 16 45555769 missense probably damaging 1.00
R6277:Slc9c1 UTSW 16 45606841 utr 3 prime probably benign
R6286:Slc9c1 UTSW 16 45577831 missense probably benign 0.14
R7268:Slc9c1 UTSW 16 45550116 missense probably damaging 1.00
R7272:Slc9c1 UTSW 16 45581515 missense possibly damaging 0.89
R7431:Slc9c1 UTSW 16 45593484 missense probably damaging 1.00
R7573:Slc9c1 UTSW 16 45577893 missense probably benign 0.00
V8831:Slc9c1 UTSW 16 45577899 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CTCTGTGTCAGGTCCCACAC -3'
(R):5'- AATAACATCATTTGGAGAGTTGGTTGG -3'

Sequencing Primer
(F):5'- CTGTTGTTGCGACAGACTACAAC -3'
(R):5'- GGTTAGTGTGAGATGCTTTAATTCAC -3'
Posted On2015-04-17