Incidental Mutation 'R3936:Arx'
ID307196
Institutional Source Beutler Lab
Gene Symbol Arx
Ensembl Gene ENSMUSG00000035277
Gene Namearistaless related homeobox
Synonyms
Accession Numbers
Is this an essential gene? Not available question?
Stock #R3936 (G1)
Quality Score144
Status Not validated
ChromosomeX
Chromosomal Location93286445-93298357 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 93297369 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 554 (L554Q)
Ref Sequence ENSEMBL: ENSMUSP00000109580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046565] [ENSMUST00000113947]
Predicted Effect probably damaging
Transcript: ENSMUST00000046565
AA Change: L554Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049039
Gene: ENSMUSG00000035277
AA Change: L554Q

DomainStartEndE-ValueType
low complexity region 81 97 N/A INTRINSIC
low complexity region 99 139 N/A INTRINSIC
low complexity region 143 154 N/A INTRINSIC
coiled coil region 221 253 N/A INTRINSIC
low complexity region 267 286 N/A INTRINSIC
HOX 330 392 9.11e-30 SMART
low complexity region 426 465 N/A INTRINSIC
low complexity region 488 503 N/A INTRINSIC
Pfam:OAR 527 547 9.9e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113947
AA Change: L554Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109580
Gene: ENSMUSG00000035277
AA Change: L554Q

DomainStartEndE-ValueType
low complexity region 81 97 N/A INTRINSIC
low complexity region 99 139 N/A INTRINSIC
low complexity region 143 154 N/A INTRINSIC
coiled coil region 221 253 N/A INTRINSIC
low complexity region 267 286 N/A INTRINSIC
HOX 330 392 9.11e-30 SMART
low complexity region 426 465 N/A INTRINSIC
low complexity region 488 503 N/A INTRINSIC
Pfam:OAR 528 546 4.4e-11 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a transcription factor that plays an important role in the development of forebrain. Male mice lacking this gene have smaller brains, olfactory bulbs and testes, and die within half a day after birth. Mice lacking this gene specifically in ganglionic eminence-derived neurons, including cortical interneurons, develop seizures. Mutations in this gene have been demonstrated to cause mouse phenotypes resembling human X-linked lissencephaly and mental retardation with epilepsy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Males hemizygous for targeted null mutations die perinatally. Male mice hemizygous for various alleles with point mutations or triple repeat expansion exhibit defective GABAergic neuron migration and numbers, seizures, and/or behavioral defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 C T 12: 53,140,444 T1547M possibly damaging Het
Alk T A 17: 72,205,954 I337F probably damaging Het
Ank3 A T 10: 69,879,989 K491* probably null Het
Axdnd1 T C 1: 156,331,639 N203S probably benign Het
Baz2b A G 2: 59,912,761 V1622A possibly damaging Het
Btnl6 T A 17: 34,517,342 H4L probably benign Het
Dync2h1 C A 9: 7,001,482 L3835F probably damaging Het
Fcgbp T C 7: 28,075,399 F133L probably benign Het
Fnip1 A G 11: 54,480,239 probably null Het
G6pc A G 11: 101,374,603 I154V probably benign Het
Golgb1 G T 16: 36,914,056 E1222* probably null Het
Gpr85 A G 6: 13,836,045 F287L probably benign Het
Gzmk A T 13: 113,173,025 S164T probably damaging Het
Il22ra2 T A 10: 19,631,708 S156R probably benign Het
Kansl1 A T 11: 104,343,543 D712E possibly damaging Het
Mc3r T A 2: 172,249,296 I146N probably damaging Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mitf C T 6: 97,993,253 P54S probably damaging Het
Olfr156 T A 4: 43,821,359 M1L probably benign Het
P4hb A C 11: 120,562,409 H440Q probably benign Het
Pbsn T C X: 77,848,096 T32A probably damaging Het
Rptn A C 3: 93,395,576 H72P possibly damaging Het
Scn1a T C 2: 66,327,776 I418V probably damaging Het
Sf3a1 T A 11: 4,180,024 probably null Het
Slc35f1 C T 10: 53,108,218 T358I probably damaging Het
Slc9c1 A G 16: 45,606,830 probably benign Het
Sorcs3 T A 19: 48,713,504 V608D probably damaging Het
Sult2b1 C T 7: 45,742,216 V49M probably benign Het
Tlr11 A G 14: 50,362,735 E726G possibly damaging Het
Treh C T 9: 44,684,543 R342W probably benign Het
Other mutations in Arx
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3935:Arx UTSW X 93297369 missense probably damaging 1.00
Z1176:Arx UTSW X 93289184 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACAGGCTCTTTTCCACTATGG -3'
(R):5'- TTAGCGCCAAGAACTGCCTTG -3'

Sequencing Primer
(F):5'- TGACCAGCGCGTCGACTG -3'
(R):5'- AAGAACTGCCTTGTCCGC -3'
Posted On2015-04-17