Incidental Mutation 'R3937:Fcamr'
ID307199
Institutional Source Beutler Lab
Gene Symbol Fcamr
Ensembl Gene ENSMUSG00000026415
Gene NameFc receptor, IgA, IgM, high affinity
Synonyms
MMRRC Submission 040921-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R3937 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location130800902-130814740 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 130804576 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 44 (H44L)
Ref Sequence ENSEMBL: ENSMUSP00000027670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027670] [ENSMUST00000112477]
Predicted Effect probably damaging
Transcript: ENSMUST00000027670
AA Change: H44L

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000027670
Gene: ENSMUSG00000026415
AA Change: H44L

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 87 191 1.19e-5 SMART
low complexity region 208 220 N/A INTRINSIC
low complexity region 241 253 N/A INTRINSIC
transmembrane domain 456 475 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112477
AA Change: H100L

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108096
Gene: ENSMUSG00000026415
AA Change: H100L

DomainStartEndE-ValueType
low complexity region 80 87 N/A INTRINSIC
IG 143 247 1.19e-5 SMART
low complexity region 264 276 N/A INTRINSIC
low complexity region 297 309 N/A INTRINSIC
transmembrane domain 512 531 N/A INTRINSIC
Meta Mutation Damage Score 0.1845 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (60/60)
MGI Phenotype PHENOTYPE: Homozygous null mice have enhanced germinal center formation, affinity maturation and memory induction of IgG3 producing B cells after immunization with T cell-independent antigens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T G 4: 147,942,053 S343R possibly damaging Het
Abca8b G T 11: 109,974,567 P355T probably benign Het
Abhd15 T C 11: 77,515,938 V247A probably benign Het
Adamts1 C T 16: 85,795,619 V634M possibly damaging Het
BC049715 T C 6: 136,840,455 I231T possibly damaging Het
Chpf A T 1: 75,477,540 V198E probably damaging Het
Cp C T 3: 19,971,034 P386S probably damaging Het
Cth A G 3: 157,920,040 I107T possibly damaging Het
Ctrc T C 4: 141,840,321 D157G probably damaging Het
D630003M21Rik A G 2: 158,200,360 Y889H probably damaging Het
Elavl3 A G 9: 22,018,744 V288A probably damaging Het
Esyt3 A T 9: 99,336,192 I130K probably benign Het
F13a1 A T 13: 36,916,901 V423D probably damaging Het
Faf1 T C 4: 109,757,692 probably benign Het
Fam227b A T 2: 126,127,060 D31E probably benign Het
Fastkd2 A G 1: 63,737,836 D377G possibly damaging Het
Fbxl6 G A 15: 76,536,624 R384* probably null Het
Fhod3 A G 18: 25,090,761 N1055D probably benign Het
Garem1 A T 18: 21,148,806 Y164* probably null Het
Gemin4 C T 11: 76,212,888 C349Y probably damaging Het
Gnal A G 18: 67,135,370 probably null Het
Hacl1 T C 14: 31,634,191 probably benign Het
Hectd3 T C 4: 116,998,530 V409A probably benign Het
Hps6 A G 19: 46,004,053 E143G probably damaging Het
Hspa4 T A 11: 53,270,949 I459L probably benign Het
Ighv3-6 G A 12: 114,288,441 Q21* probably null Het
Ints3 G A 3: 90,403,987 R438* probably null Het
Jmjd6 T C 11: 116,841,165 N237D probably benign Het
Lrrk2 C A 15: 91,778,504 T1912K probably damaging Het
Mdga2 C A 12: 67,221,206 probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Myh6 T C 14: 54,963,055 D203G probably benign Het
Myo5b T C 18: 74,716,037 S1116P probably damaging Het
Nalcn T A 14: 123,369,945 D704V probably benign Het
Nes A T 3: 87,971,236 M12L probably benign Het
Olfr1052 T A 2: 86,298,016 S67T probably damaging Het
Olfr118 A G 17: 37,672,967 T315A probably benign Het
Olfr1328 T C 4: 118,934,683 D53G probably damaging Het
Olfr453 T A 6: 42,744,076 I13N probably damaging Het
Pcdha2 T C 18: 36,941,323 V669A probably benign Het
Pdhx T C 2: 103,022,219 N433S probably damaging Het
Pip5kl1 A G 2: 32,579,112 R261G probably damaging Het
Plekhj1 A G 10: 80,797,775 I76T probably damaging Het
Ppp1r3a A T 6: 14,719,074 S614T probably damaging Het
Ptpru T C 4: 131,774,304 N1207S probably damaging Het
Ranbp2 T C 10: 58,476,472 F1005L probably benign Het
Rims2 A G 15: 39,437,845 E324G probably damaging Het
Sema6d A T 2: 124,656,850 I227L probably benign Het
Smarcad1 T G 6: 65,114,336 L1014V probably damaging Het
Spag9 T C 11: 94,044,417 V18A possibly damaging Het
Spag9 T G 11: 94,044,479 S39A possibly damaging Het
Sun2 T C 15: 79,734,155 K268E probably benign Het
Tbpl2 C T 2: 24,087,139 R289Q probably benign Het
Tcea3 T A 4: 136,255,143 probably benign Het
Tmem185a C T X: 70,462,186 probably null Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Vmn1r212 A T 13: 22,883,188 V325E unknown Het
Vmn1r35 T A 6: 66,679,073 R204S probably damaging Het
Vmn2r57 A G 7: 41,428,130 M204T probably damaging Het
Wdfy3 A T 5: 101,944,239 Y411* probably null Het
Zfp335 G T 2: 164,910,700 D41E probably damaging Het
Other mutations in Fcamr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:Fcamr APN 1 130813214 missense probably benign 0.01
IGL02880:Fcamr APN 1 130813334 missense probably benign 0.00
IGL03199:Fcamr APN 1 130812918 missense probably damaging 1.00
IGL03392:Fcamr APN 1 130800948 utr 5 prime probably benign
IGL03398:Fcamr APN 1 130803248 missense probably damaging 0.97
R1101:Fcamr UTSW 1 130814486 splice site probably null
R1312:Fcamr UTSW 1 130811487 missense probably damaging 1.00
R1351:Fcamr UTSW 1 130813020 missense possibly damaging 0.83
R1387:Fcamr UTSW 1 130804642 missense possibly damaging 0.85
R1475:Fcamr UTSW 1 130814484 splice site probably null
R1728:Fcamr UTSW 1 130804569 missense probably benign 0.06
R1728:Fcamr UTSW 1 130804627 missense probably benign 0.00
R1728:Fcamr UTSW 1 130811580 missense probably benign
R1728:Fcamr UTSW 1 130812629 missense probably benign 0.38
R1728:Fcamr UTSW 1 130812692 missense probably benign
R1728:Fcamr UTSW 1 130812738 missense probably benign 0.00
R1728:Fcamr UTSW 1 130812809 missense probably benign 0.02
R1728:Fcamr UTSW 1 130812816 missense probably benign 0.41
R1728:Fcamr UTSW 1 130814597 missense probably benign
R1729:Fcamr UTSW 1 130804627 missense probably benign 0.00
R1729:Fcamr UTSW 1 130811580 missense probably benign
R1729:Fcamr UTSW 1 130812629 missense probably benign 0.38
R1729:Fcamr UTSW 1 130812692 missense probably benign
R1729:Fcamr UTSW 1 130812738 missense probably benign 0.00
R1729:Fcamr UTSW 1 130812809 missense probably benign 0.02
R1729:Fcamr UTSW 1 130812816 missense probably benign 0.41
R1729:Fcamr UTSW 1 130814597 missense probably benign
R1730:Fcamr UTSW 1 130811580 missense probably benign
R1730:Fcamr UTSW 1 130812629 missense probably benign 0.38
R1730:Fcamr UTSW 1 130812692 missense probably benign
R1730:Fcamr UTSW 1 130812738 missense probably benign 0.00
R1730:Fcamr UTSW 1 130812809 missense probably benign 0.02
R1730:Fcamr UTSW 1 130812816 missense probably benign 0.41
R1730:Fcamr UTSW 1 130814597 missense probably benign
R1739:Fcamr UTSW 1 130804627 missense probably benign 0.00
R1739:Fcamr UTSW 1 130811580 missense probably benign
R1739:Fcamr UTSW 1 130812629 missense probably benign 0.38
R1739:Fcamr UTSW 1 130812692 missense probably benign
R1739:Fcamr UTSW 1 130812738 missense probably benign 0.00
R1739:Fcamr UTSW 1 130812809 missense probably benign 0.02
R1739:Fcamr UTSW 1 130812816 missense probably benign 0.41
R1739:Fcamr UTSW 1 130814597 missense probably benign
R1762:Fcamr UTSW 1 130804627 missense probably benign 0.00
R1762:Fcamr UTSW 1 130811580 missense probably benign
R1762:Fcamr UTSW 1 130812629 missense probably benign 0.38
R1762:Fcamr UTSW 1 130812692 missense probably benign
R1762:Fcamr UTSW 1 130812738 missense probably benign 0.00
R1762:Fcamr UTSW 1 130812809 missense probably benign 0.02
R1762:Fcamr UTSW 1 130812816 missense probably benign 0.41
R1762:Fcamr UTSW 1 130814597 missense probably benign
R1783:Fcamr UTSW 1 130804627 missense probably benign 0.00
R1783:Fcamr UTSW 1 130811580 missense probably benign
R1783:Fcamr UTSW 1 130812629 missense probably benign 0.38
R1783:Fcamr UTSW 1 130812692 missense probably benign
R1783:Fcamr UTSW 1 130812738 missense probably benign 0.00
R1783:Fcamr UTSW 1 130812809 missense probably benign 0.02
R1783:Fcamr UTSW 1 130812816 missense probably benign 0.41
R1783:Fcamr UTSW 1 130814597 missense probably benign
R1784:Fcamr UTSW 1 130804627 missense probably benign 0.00
R1784:Fcamr UTSW 1 130811580 missense probably benign
R1784:Fcamr UTSW 1 130812629 missense probably benign 0.38
R1784:Fcamr UTSW 1 130812692 missense probably benign
R1784:Fcamr UTSW 1 130812738 missense probably benign 0.00
R1784:Fcamr UTSW 1 130812809 missense probably benign 0.02
R1784:Fcamr UTSW 1 130812816 missense probably benign 0.41
R1784:Fcamr UTSW 1 130814597 missense probably benign
R1785:Fcamr UTSW 1 130804569 missense probably benign 0.06
R1785:Fcamr UTSW 1 130804627 missense probably benign 0.00
R1785:Fcamr UTSW 1 130811580 missense probably benign
R1785:Fcamr UTSW 1 130812629 missense probably benign 0.38
R1785:Fcamr UTSW 1 130812692 missense probably benign
R1785:Fcamr UTSW 1 130812738 missense probably benign 0.00
R1785:Fcamr UTSW 1 130812809 missense probably benign 0.02
R1785:Fcamr UTSW 1 130812816 missense probably benign 0.41
R1785:Fcamr UTSW 1 130814597 missense probably benign
R1793:Fcamr UTSW 1 130811547 missense probably benign 0.03
R2085:Fcamr UTSW 1 130811598 missense probably damaging 1.00
R4529:Fcamr UTSW 1 130804576 missense probably damaging 0.99
R4624:Fcamr UTSW 1 130803262 missense probably damaging 0.99
R4822:Fcamr UTSW 1 130812686 missense possibly damaging 0.82
R5055:Fcamr UTSW 1 130811437 missense probably damaging 1.00
R5514:Fcamr UTSW 1 130814056 missense probably damaging 1.00
R5807:Fcamr UTSW 1 130811526 missense probably damaging 1.00
R6077:Fcamr UTSW 1 130812926 missense probably damaging 1.00
R6200:Fcamr UTSW 1 130803190 missense probably benign 0.16
R6653:Fcamr UTSW 1 130813202 missense possibly damaging 0.89
R7081:Fcamr UTSW 1 130813212 missense probably damaging 1.00
R7362:Fcamr UTSW 1 130814023 missense possibly damaging 0.52
R7828:Fcamr UTSW 1 130811706 missense probably damaging 1.00
X0012:Fcamr UTSW 1 130812734 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CATTAAGAGGTGTAGTCTTTGGCTC -3'
(R):5'- ACTGCAGGCCTTATACTGGG -3'

Sequencing Primer
(F):5'- TACCCAGCAGATTTAGAGTGAGC -3'
(R):5'- CTGCAGGCCTTATACTGGGATAAGAC -3'
Posted On2015-04-17