Incidental Mutation 'R0375:Dsg4'
ID 30720
Institutional Source Beutler Lab
Gene Symbol Dsg4
Ensembl Gene ENSMUSG00000001804
Gene Name desmoglein 4
Synonyms CDHF13, lah
MMRRC Submission 038581-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.507) question?
Stock # R0375 (G1)
Quality Score 190
Status Validated
Chromosome 18
Chromosomal Location 20569232-20604878 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 20603936 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 801 (D801G)
Ref Sequence ENSEMBL: ENSMUSP00000019426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019426]
AlphaFold Q7TMD7
Predicted Effect probably damaging
Transcript: ENSMUST00000019426
AA Change: D801G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019426
Gene: ENSMUSG00000001804
AA Change: D801G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 70 155 1.54e-11 SMART
CA 179 267 4.27e-19 SMART
CA 290 384 5.48e-8 SMART
CA 411 495 9.4e-7 SMART
transmembrane domain 634 656 N/A INTRINSIC
low complexity region 724 736 N/A INTRINSIC
Pfam:Cadherin_C 749 849 3.1e-8 PFAM
Meta Mutation Damage Score 0.7374 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. This gene is expressed in the suprabasal epidermis and hair follicle. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the lanceolate hair phenotype in mice. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice carrying mutations at this locus exhibit abnormalities in hair growth, vibrissae growth, and a thickened epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730522E02Rik T A 11: 25,719,092 (GRCm39) Y17F unknown Het
Aars2 A G 17: 45,825,476 (GRCm39) D313G probably damaging Het
Abca9 A T 11: 110,006,273 (GRCm39) D1277E probably benign Het
Adgrl1 G T 8: 84,661,530 (GRCm39) A981S probably damaging Het
Aff3 T G 1: 38,244,021 (GRCm39) K917Q possibly damaging Het
BC049715 A T 6: 136,816,994 (GRCm39) H78L probably benign Het
Bltp1 C T 3: 37,100,401 (GRCm39) T4707I probably damaging Het
Cacna1g C A 11: 94,301,880 (GRCm39) A2027S possibly damaging Het
Camk1g G A 1: 193,038,709 (GRCm39) probably benign Het
Carf T C 1: 60,183,161 (GRCm39) V386A probably damaging Het
Cd46 A G 1: 194,768,472 (GRCm39) S82P probably benign Het
Clic5 A G 17: 44,581,510 (GRCm39) E180G possibly damaging Het
Col27a1 A G 4: 63,143,898 (GRCm39) T529A probably benign Het
Col7a1 C T 9: 108,809,305 (GRCm39) R2627C unknown Het
Cuzd1 G A 7: 130,913,637 (GRCm39) probably benign Het
Cwc27 T C 13: 104,944,331 (GRCm39) D50G possibly damaging Het
Dhx38 A G 8: 110,281,813 (GRCm39) V735A possibly damaging Het
Dhx57 T G 17: 80,565,550 (GRCm39) E834A probably damaging Het
Dtx1 T C 5: 120,819,464 (GRCm39) E578G probably damaging Het
F830016B08Rik A T 18: 60,433,265 (GRCm39) H116L probably damaging Het
Fbxw18 T C 9: 109,517,907 (GRCm39) I360V possibly damaging Het
Fignl2 G A 15: 100,951,974 (GRCm39) P103S probably benign Het
Frmpd1 A G 4: 45,284,196 (GRCm39) T1006A probably benign Het
Ggnbp2 G T 11: 84,727,200 (GRCm39) C545* probably null Het
Gm3336 A G 8: 71,171,294 (GRCm39) probably benign Het
Gpr37 T C 6: 25,669,290 (GRCm39) N518S probably benign Het
Hbs1l T A 10: 21,218,440 (GRCm39) D312E possibly damaging Het
Hoxd10 C A 2: 74,523,064 (GRCm39) S247R probably benign Het
Ifnb1 A T 4: 88,440,981 (GRCm39) F11I probably benign Het
Marf1 T C 16: 13,969,184 (GRCm39) probably benign Het
Myo1f T A 17: 33,820,930 (GRCm39) V879E probably benign Het
Naip1 A G 13: 100,545,656 (GRCm39) F1291L probably benign Het
Nckap1l A G 15: 103,382,586 (GRCm39) E529G probably damaging Het
Npm3 T C 19: 45,736,668 (GRCm39) E157G probably damaging Het
Or10x4 A G 1: 174,218,775 (GRCm39) T47A probably damaging Het
Or4a67 T A 2: 88,597,985 (GRCm39) T225S possibly damaging Het
Or4a68 G T 2: 89,269,740 (GRCm39) N294K probably benign Het
Pex16 G A 2: 92,210,802 (GRCm39) G312D probably damaging Het
Ppp6r1 A G 7: 4,636,286 (GRCm39) V768A probably benign Het
Prrc1 A G 18: 57,495,564 (GRCm39) T14A probably damaging Het
Ranbp2 T C 10: 58,313,105 (GRCm39) L1275P probably damaging Het
Rnf214 C A 9: 45,811,121 (GRCm39) V181F probably damaging Het
Ror2 T C 13: 53,286,040 (GRCm39) N58S probably damaging Het
Selplg G A 5: 113,958,069 (GRCm39) T79I probably damaging Het
Setd1b G A 5: 123,295,500 (GRCm39) G1023S unknown Het
Sf3b2 C T 19: 5,324,852 (GRCm39) D845N probably damaging Het
Skint5 A G 4: 113,562,793 (GRCm39) V803A unknown Het
Slc25a46 T C 18: 31,716,319 (GRCm39) I394M possibly damaging Het
Snrnp27 A T 6: 86,657,935 (GRCm39) I101K possibly damaging Het
Spag17 C A 3: 99,934,906 (GRCm39) T704K probably benign Het
Tas2r144 T A 6: 42,193,058 (GRCm39) M266K possibly damaging Het
Tasor2 A G 13: 3,646,842 (GRCm39) V61A possibly damaging Het
Tbc1d31 T A 15: 57,818,746 (GRCm39) L783H probably benign Het
Tbck C A 3: 132,456,993 (GRCm39) probably benign Het
Vcan A G 13: 89,839,394 (GRCm39) V2050A probably damaging Het
Vmn1r70 T A 7: 10,367,987 (GRCm39) N158K probably damaging Het
Vmn2r103 T A 17: 20,013,121 (GRCm39) Y81N probably benign Het
Vmn2r103 A G 17: 20,013,726 (GRCm39) T173A probably benign Het
Ylpm1 T G 12: 85,061,754 (GRCm39) S552A unknown Het
Zdhhc17 A T 10: 110,817,967 (GRCm39) Y58* probably null Het
Other mutations in Dsg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Dsg4 APN 18 20,594,383 (GRCm39) missense probably benign 0.22
IGL01723:Dsg4 APN 18 20,599,567 (GRCm39) missense probably damaging 1.00
IGL02249:Dsg4 APN 18 20,594,361 (GRCm39) missense possibly damaging 0.69
IGL02445:Dsg4 APN 18 20,579,307 (GRCm39) splice site probably benign
IGL02553:Dsg4 APN 18 20,595,577 (GRCm39) missense probably benign
IGL02578:Dsg4 APN 18 20,604,250 (GRCm39) missense possibly damaging 0.94
IGL02634:Dsg4 APN 18 20,591,637 (GRCm39) missense probably benign 0.01
IGL02677:Dsg4 APN 18 20,597,933 (GRCm39) missense possibly damaging 0.62
IGL02741:Dsg4 APN 18 20,604,553 (GRCm39) missense probably benign
IGL02747:Dsg4 APN 18 20,579,995 (GRCm39) missense probably damaging 0.97
IGL03342:Dsg4 APN 18 20,584,880 (GRCm39) missense probably damaging 1.00
burrito UTSW 18 20,584,919 (GRCm39) missense possibly damaging 0.81
woodshed UTSW 18 20,584,929 (GRCm39) nonsense probably null
R0043:Dsg4 UTSW 18 20,586,029 (GRCm39) missense probably damaging 1.00
R0537:Dsg4 UTSW 18 20,591,628 (GRCm39) missense probably damaging 1.00
R0619:Dsg4 UTSW 18 20,594,416 (GRCm39) missense probably benign 0.00
R0622:Dsg4 UTSW 18 20,582,845 (GRCm39) missense possibly damaging 0.51
R0765:Dsg4 UTSW 18 20,587,703 (GRCm39) splice site probably benign
R0786:Dsg4 UTSW 18 20,582,429 (GRCm39) critical splice donor site probably null
R1114:Dsg4 UTSW 18 20,599,540 (GRCm39) missense possibly damaging 0.62
R1249:Dsg4 UTSW 18 20,579,929 (GRCm39) nonsense probably null
R1372:Dsg4 UTSW 18 20,582,733 (GRCm39) splice site probably null
R1382:Dsg4 UTSW 18 20,598,181 (GRCm39) missense probably benign 0.00
R1392:Dsg4 UTSW 18 20,579,304 (GRCm39) splice site probably benign
R1442:Dsg4 UTSW 18 20,595,717 (GRCm39) missense possibly damaging 0.76
R1503:Dsg4 UTSW 18 20,582,736 (GRCm39) missense probably damaging 1.00
R1704:Dsg4 UTSW 18 20,604,646 (GRCm39) missense probably damaging 1.00
R1716:Dsg4 UTSW 18 20,595,518 (GRCm39) nonsense probably null
R1765:Dsg4 UTSW 18 20,589,888 (GRCm39) missense probably benign 0.01
R1817:Dsg4 UTSW 18 20,604,302 (GRCm39) missense probably damaging 1.00
R1982:Dsg4 UTSW 18 20,604,269 (GRCm39) missense probably damaging 1.00
R2025:Dsg4 UTSW 18 20,599,693 (GRCm39) nonsense probably null
R2097:Dsg4 UTSW 18 20,604,101 (GRCm39) missense probably damaging 1.00
R2198:Dsg4 UTSW 18 20,594,499 (GRCm39) missense probably benign
R3551:Dsg4 UTSW 18 20,584,813 (GRCm39) missense probably damaging 1.00
R3742:Dsg4 UTSW 18 20,604,058 (GRCm39) missense probably damaging 1.00
R3853:Dsg4 UTSW 18 20,582,291 (GRCm39) missense probably benign
R3955:Dsg4 UTSW 18 20,582,432 (GRCm39) splice site probably null
R4006:Dsg4 UTSW 18 20,604,022 (GRCm39) missense probably damaging 0.97
R4012:Dsg4 UTSW 18 20,584,919 (GRCm39) missense possibly damaging 0.81
R4171:Dsg4 UTSW 18 20,591,636 (GRCm39) nonsense probably null
R4254:Dsg4 UTSW 18 20,604,595 (GRCm39) missense probably benign 0.07
R4504:Dsg4 UTSW 18 20,594,493 (GRCm39) missense probably benign 0.00
R4559:Dsg4 UTSW 18 20,603,978 (GRCm39) missense probably damaging 1.00
R4607:Dsg4 UTSW 18 20,604,302 (GRCm39) missense probably damaging 1.00
R4612:Dsg4 UTSW 18 20,595,470 (GRCm39) missense probably benign 0.10
R4683:Dsg4 UTSW 18 20,594,466 (GRCm39) missense probably benign
R4700:Dsg4 UTSW 18 20,589,965 (GRCm39) missense possibly damaging 0.91
R4749:Dsg4 UTSW 18 20,579,888 (GRCm39) missense possibly damaging 0.88
R4775:Dsg4 UTSW 18 20,604,184 (GRCm39) missense possibly damaging 0.48
R4809:Dsg4 UTSW 18 20,599,678 (GRCm39) missense possibly damaging 0.82
R5276:Dsg4 UTSW 18 20,579,896 (GRCm39) missense probably benign 0.21
R5426:Dsg4 UTSW 18 20,591,541 (GRCm39) missense probably damaging 1.00
R5767:Dsg4 UTSW 18 20,595,549 (GRCm39) nonsense probably null
R5982:Dsg4 UTSW 18 20,598,226 (GRCm39) missense possibly damaging 0.76
R6280:Dsg4 UTSW 18 20,599,724 (GRCm39) missense probably damaging 1.00
R6305:Dsg4 UTSW 18 20,582,847 (GRCm39) missense probably damaging 1.00
R6489:Dsg4 UTSW 18 20,604,420 (GRCm39) missense possibly damaging 0.93
R7013:Dsg4 UTSW 18 20,591,578 (GRCm39) missense possibly damaging 0.58
R7040:Dsg4 UTSW 18 20,584,909 (GRCm39) missense probably benign 0.01
R7196:Dsg4 UTSW 18 20,599,537 (GRCm39) missense probably damaging 1.00
R7432:Dsg4 UTSW 18 20,579,323 (GRCm39) nonsense probably null
R7438:Dsg4 UTSW 18 20,599,685 (GRCm39) missense probably damaging 0.96
R7490:Dsg4 UTSW 18 20,584,993 (GRCm39) splice site probably null
R7612:Dsg4 UTSW 18 20,604,047 (GRCm39) missense probably damaging 1.00
R7639:Dsg4 UTSW 18 20,582,769 (GRCm39) missense probably damaging 1.00
R7905:Dsg4 UTSW 18 20,587,726 (GRCm39) missense probably damaging 1.00
R8251:Dsg4 UTSW 18 20,604,221 (GRCm39) missense probably damaging 1.00
R8326:Dsg4 UTSW 18 20,582,788 (GRCm39) missense probably benign 0.31
R8554:Dsg4 UTSW 18 20,586,100 (GRCm39) missense probably damaging 1.00
R8911:Dsg4 UTSW 18 20,584,929 (GRCm39) nonsense probably null
R9059:Dsg4 UTSW 18 20,604,182 (GRCm39) missense possibly damaging 0.62
R9508:Dsg4 UTSW 18 20,604,070 (GRCm39) missense probably damaging 1.00
R9607:Dsg4 UTSW 18 20,586,047 (GRCm39) missense probably benign 0.00
R9765:Dsg4 UTSW 18 20,604,334 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGGAGACTAACAAGATGACCCAGCA -3'
(R):5'- CTGTGTCCAAGCAGATTTCAGCTAGAG -3'

Sequencing Primer
(F):5'- atctgcctgcctctgcc -3'
(R):5'- AGCAGATTTCAGCTAGAGTCCTG -3'
Posted On 2013-04-24