Incidental Mutation 'R3937:Olfr1052'
ID307203
Institutional Source Beutler Lab
Gene Symbol Olfr1052
Ensembl Gene ENSMUSG00000047149
Gene Nameolfactory receptor 1052
SynonymsGA_x6K02T2Q125-47777498-47778436, MOR172-1
MMRRC Submission 040921-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R3937 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86292455-86299233 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86298016 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 67 (S67T)
Ref Sequence ENSEMBL: ENSMUSP00000149344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054746] [ENSMUST00000215090] [ENSMUST00000217166]
Predicted Effect probably damaging
Transcript: ENSMUST00000054746
AA Change: S67T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058454
Gene: ENSMUSG00000047149
AA Change: S67T

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.3e-51 PFAM
Pfam:7tm_1 41 290 6.9e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215090
AA Change: S67T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217166
AA Change: S67T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.5777 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T G 4: 147,942,053 S343R possibly damaging Het
Abca8b G T 11: 109,974,567 P355T probably benign Het
Abhd15 T C 11: 77,515,938 V247A probably benign Het
Adamts1 C T 16: 85,795,619 V634M possibly damaging Het
BC049715 T C 6: 136,840,455 I231T possibly damaging Het
Chpf A T 1: 75,477,540 V198E probably damaging Het
Cp C T 3: 19,971,034 P386S probably damaging Het
Cth A G 3: 157,920,040 I107T possibly damaging Het
Ctrc T C 4: 141,840,321 D157G probably damaging Het
D630003M21Rik A G 2: 158,200,360 Y889H probably damaging Het
Elavl3 A G 9: 22,018,744 V288A probably damaging Het
Esyt3 A T 9: 99,336,192 I130K probably benign Het
F13a1 A T 13: 36,916,901 V423D probably damaging Het
Faf1 T C 4: 109,757,692 probably benign Het
Fam227b A T 2: 126,127,060 D31E probably benign Het
Fastkd2 A G 1: 63,737,836 D377G possibly damaging Het
Fbxl6 G A 15: 76,536,624 R384* probably null Het
Fcamr A T 1: 130,804,576 H44L probably damaging Het
Fhod3 A G 18: 25,090,761 N1055D probably benign Het
Garem1 A T 18: 21,148,806 Y164* probably null Het
Gemin4 C T 11: 76,212,888 C349Y probably damaging Het
Gnal A G 18: 67,135,370 probably null Het
Hacl1 T C 14: 31,634,191 probably benign Het
Hectd3 T C 4: 116,998,530 V409A probably benign Het
Hps6 A G 19: 46,004,053 E143G probably damaging Het
Hspa4 T A 11: 53,270,949 I459L probably benign Het
Ighv3-6 G A 12: 114,288,441 Q21* probably null Het
Ints3 G A 3: 90,403,987 R438* probably null Het
Jmjd6 T C 11: 116,841,165 N237D probably benign Het
Lrrk2 C A 15: 91,778,504 T1912K probably damaging Het
Mdga2 C A 12: 67,221,206 probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Myh6 T C 14: 54,963,055 D203G probably benign Het
Myo5b T C 18: 74,716,037 S1116P probably damaging Het
Nalcn T A 14: 123,369,945 D704V probably benign Het
Nes A T 3: 87,971,236 M12L probably benign Het
Olfr118 A G 17: 37,672,967 T315A probably benign Het
Olfr1328 T C 4: 118,934,683 D53G probably damaging Het
Olfr453 T A 6: 42,744,076 I13N probably damaging Het
Pcdha2 T C 18: 36,941,323 V669A probably benign Het
Pdhx T C 2: 103,022,219 N433S probably damaging Het
Pip5kl1 A G 2: 32,579,112 R261G probably damaging Het
Plekhj1 A G 10: 80,797,775 I76T probably damaging Het
Ppp1r3a A T 6: 14,719,074 S614T probably damaging Het
Ptpru T C 4: 131,774,304 N1207S probably damaging Het
Ranbp2 T C 10: 58,476,472 F1005L probably benign Het
Rims2 A G 15: 39,437,845 E324G probably damaging Het
Sema6d A T 2: 124,656,850 I227L probably benign Het
Smarcad1 T G 6: 65,114,336 L1014V probably damaging Het
Spag9 T C 11: 94,044,417 V18A possibly damaging Het
Spag9 T G 11: 94,044,479 S39A possibly damaging Het
Sun2 T C 15: 79,734,155 K268E probably benign Het
Tbpl2 C T 2: 24,087,139 R289Q probably benign Het
Tcea3 T A 4: 136,255,143 probably benign Het
Tmem185a C T X: 70,462,186 probably null Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Vmn1r212 A T 13: 22,883,188 V325E unknown Het
Vmn1r35 T A 6: 66,679,073 R204S probably damaging Het
Vmn2r57 A G 7: 41,428,130 M204T probably damaging Het
Wdfy3 A T 5: 101,944,239 Y411* probably null Het
Zfp335 G T 2: 164,910,700 D41E probably damaging Het
Other mutations in Olfr1052
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02632:Olfr1052 APN 2 86298560 missense probably damaging 0.99
IGL02988:Olfr1052 UTSW 2 86298479 missense probably damaging 0.99
R0382:Olfr1052 UTSW 2 86298593 missense probably damaging 1.00
R0569:Olfr1052 UTSW 2 86298597 missense probably damaging 1.00
R1476:Olfr1052 UTSW 2 86298479 missense probably damaging 0.99
R1510:Olfr1052 UTSW 2 86298371 missense probably damaging 1.00
R1667:Olfr1052 UTSW 2 86298736 missense probably null 0.02
R2912:Olfr1052 UTSW 2 86298389 missense probably damaging 0.96
R2913:Olfr1052 UTSW 2 86298389 missense probably damaging 0.96
R4299:Olfr1052 UTSW 2 86298241 missense possibly damaging 0.46
R4774:Olfr1052 UTSW 2 86298698 missense possibly damaging 0.91
R5027:Olfr1052 UTSW 2 86298196 missense possibly damaging 0.84
R5080:Olfr1052 UTSW 2 86297914 missense probably benign 0.22
R5254:Olfr1052 UTSW 2 86297921 missense probably damaging 1.00
R5389:Olfr1052 UTSW 2 86298217 missense possibly damaging 0.90
R6110:Olfr1052 UTSW 2 86298675 missense probably damaging 0.99
R6492:Olfr1052 UTSW 2 86298646 missense probably benign 0.05
R6810:Olfr1052 UTSW 2 86297923 missense probably benign 0.01
R7095:Olfr1052 UTSW 2 86298677 missense probably benign 0.08
R7104:Olfr1052 UTSW 2 86298220 missense probably benign
R7320:Olfr1052 UTSW 2 86297994 frame shift probably null
R7328:Olfr1052 UTSW 2 86297994 frame shift probably null
R7363:Olfr1052 UTSW 2 86297994 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCCTCCTCAGGTTTGAAAGAAGG -3'
(R):5'- TGCCACATAACGGTCATAAGC -3'

Sequencing Primer
(F):5'- ATGGCTACTGAGAACTGTACAG -3'
(R):5'- GGTCATAAGCCATCACTGACAG -3'
Posted On2015-04-17