Incidental Mutation 'R3937:Sema6d'
ID307205
Institutional Source Beutler Lab
Gene Symbol Sema6d
Ensembl Gene ENSMUSG00000027200
Gene Namesema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D
SynonymsSema6D-6, 1110067B02Rik, Sema6D-1, Sema6D-2, Sema6D-4, Sema6D-5
MMRRC Submission 040921-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3937 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location124089969-124667770 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 124656850 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 227 (I227L)
Ref Sequence ENSEMBL: ENSMUSP00000099531 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051419] [ENSMUST00000076335] [ENSMUST00000077847] [ENSMUST00000078621] [ENSMUST00000103238] [ENSMUST00000103239] [ENSMUST00000103240] [ENSMUST00000103241]
Predicted Effect probably benign
Transcript: ENSMUST00000051419
AA Change: I227L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000061123
Gene: ENSMUSG00000027200
AA Change: I227L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 582 4.57e-1 SMART
transmembrane domain 602 624 N/A INTRINSIC
low complexity region 743 764 N/A INTRINSIC
internal_repeat_1 797 898 7.43e-5 PROSPERO
internal_repeat_1 892 1004 7.43e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000076335
AA Change: I227L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000075674
Gene: ENSMUSG00000027200
AA Change: I227L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 569 1.12e-1 SMART
transmembrane domain 589 611 N/A INTRINSIC
low complexity region 730 751 N/A INTRINSIC
internal_repeat_1 784 885 7.28e-5 PROSPERO
internal_repeat_1 879 991 7.28e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000077847
AA Change: I227L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000077014
Gene: ENSMUSG00000027200
AA Change: I227L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 569 1.12e-1 SMART
low complexity region 573 584 N/A INTRINSIC
transmembrane domain 645 667 N/A INTRINSIC
low complexity region 786 807 N/A INTRINSIC
internal_repeat_1 840 941 5.95e-5 PROSPERO
internal_repeat_1 935 1047 5.95e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000078621
AA Change: I227L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000077691
Gene: ENSMUSG00000027200
AA Change: I227L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 582 4.57e-1 SMART
transmembrane domain 621 643 N/A INTRINSIC
low complexity region 762 783 N/A INTRINSIC
internal_repeat_1 816 917 8.83e-5 PROSPERO
internal_repeat_1 911 1023 8.83e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000103238
AA Change: I227L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000099528
Gene: ENSMUSG00000027200
AA Change: I227L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 569 1.12e-1 SMART
low complexity region 573 584 N/A INTRINSIC
transmembrane domain 645 667 N/A INTRINSIC
low complexity region 786 807 N/A INTRINSIC
internal_repeat_1 840 941 5.95e-5 PROSPERO
internal_repeat_1 935 1047 5.95e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000103239
AA Change: I227L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000099529
Gene: ENSMUSG00000027200
AA Change: I227L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 569 1.12e-1 SMART
low complexity region 587 603 N/A INTRINSIC
transmembrane domain 664 686 N/A INTRINSIC
low complexity region 805 826 N/A INTRINSIC
internal_repeat_1 859 960 5.78e-5 PROSPERO
internal_repeat_1 954 1066 5.78e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000103240
AA Change: I227L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099530
Gene: ENSMUSG00000027200
AA Change: I227L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 569 1.12e-1 SMART
low complexity region 587 603 N/A INTRINSIC
transmembrane domain 660 682 N/A INTRINSIC
low complexity region 801 822 N/A INTRINSIC
internal_repeat_1 855 956 5.63e-5 PROSPERO
internal_repeat_1 950 1062 5.63e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000103241
AA Change: I227L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000099531
Gene: ENSMUSG00000027200
AA Change: I227L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 569 1.12e-1 SMART
transmembrane domain 589 611 N/A INTRINSIC
low complexity region 730 751 N/A INTRINSIC
internal_repeat_1 784 885 7.28e-5 PROSPERO
internal_repeat_1 879 991 7.28e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132088
Meta Mutation Damage Score 0.0607 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Semaphorins are a large family, including both secreted and membrane associated proteins, many of which have been implicated as inhibitors or chemorepellents in axon pathfinding, fasciculation and branching, and target selection. All semaphorins possess a semaphorin (Sema) domain and a PSI domain (found in plexins, semaphorins and integrins) in the N-terminal extracellular portion. Additional sequence motifs C-terminal to the semaphorin domain allow classification into distinct subfamilies. Results demonstrate that transmembrane semaphorins, like the secreted ones, can act as repulsive axon guidance cues. This gene encodes a class 6 vertebrate transmembrane semaphorin that demonstrates alternative splicing. Several transcript variants have been identified and expression of the distinct encoded isoforms is thought to be regulated in a tissue- and development-dependent manner. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal dendritic cell trafficking and antigen-specific T cell priming. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T G 4: 147,942,053 S343R possibly damaging Het
Abca8b G T 11: 109,974,567 P355T probably benign Het
Abhd15 T C 11: 77,515,938 V247A probably benign Het
Adamts1 C T 16: 85,795,619 V634M possibly damaging Het
BC049715 T C 6: 136,840,455 I231T possibly damaging Het
Chpf A T 1: 75,477,540 V198E probably damaging Het
Cp C T 3: 19,971,034 P386S probably damaging Het
Cth A G 3: 157,920,040 I107T possibly damaging Het
Ctrc T C 4: 141,840,321 D157G probably damaging Het
D630003M21Rik A G 2: 158,200,360 Y889H probably damaging Het
Elavl3 A G 9: 22,018,744 V288A probably damaging Het
Esyt3 A T 9: 99,336,192 I130K probably benign Het
F13a1 A T 13: 36,916,901 V423D probably damaging Het
Faf1 T C 4: 109,757,692 probably benign Het
Fam227b A T 2: 126,127,060 D31E probably benign Het
Fastkd2 A G 1: 63,737,836 D377G possibly damaging Het
Fbxl6 G A 15: 76,536,624 R384* probably null Het
Fcamr A T 1: 130,804,576 H44L probably damaging Het
Fhod3 A G 18: 25,090,761 N1055D probably benign Het
Garem1 A T 18: 21,148,806 Y164* probably null Het
Gemin4 C T 11: 76,212,888 C349Y probably damaging Het
Gnal A G 18: 67,135,370 probably null Het
Hacl1 T C 14: 31,634,191 probably benign Het
Hectd3 T C 4: 116,998,530 V409A probably benign Het
Hps6 A G 19: 46,004,053 E143G probably damaging Het
Hspa4 T A 11: 53,270,949 I459L probably benign Het
Ighv3-6 G A 12: 114,288,441 Q21* probably null Het
Ints3 G A 3: 90,403,987 R438* probably null Het
Jmjd6 T C 11: 116,841,165 N237D probably benign Het
Lrrk2 C A 15: 91,778,504 T1912K probably damaging Het
Mdga2 C A 12: 67,221,206 probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Myh6 T C 14: 54,963,055 D203G probably benign Het
Myo5b T C 18: 74,716,037 S1116P probably damaging Het
Nalcn T A 14: 123,369,945 D704V probably benign Het
Nes A T 3: 87,971,236 M12L probably benign Het
Olfr1052 T A 2: 86,298,016 S67T probably damaging Het
Olfr118 A G 17: 37,672,967 T315A probably benign Het
Olfr1328 T C 4: 118,934,683 D53G probably damaging Het
Olfr453 T A 6: 42,744,076 I13N probably damaging Het
Pcdha2 T C 18: 36,941,323 V669A probably benign Het
Pdhx T C 2: 103,022,219 N433S probably damaging Het
Pip5kl1 A G 2: 32,579,112 R261G probably damaging Het
Plekhj1 A G 10: 80,797,775 I76T probably damaging Het
Ppp1r3a A T 6: 14,719,074 S614T probably damaging Het
Ptpru T C 4: 131,774,304 N1207S probably damaging Het
Ranbp2 T C 10: 58,476,472 F1005L probably benign Het
Rims2 A G 15: 39,437,845 E324G probably damaging Het
Smarcad1 T G 6: 65,114,336 L1014V probably damaging Het
Spag9 T C 11: 94,044,417 V18A possibly damaging Het
Spag9 T G 11: 94,044,479 S39A possibly damaging Het
Sun2 T C 15: 79,734,155 K268E probably benign Het
Tbpl2 C T 2: 24,087,139 R289Q probably benign Het
Tcea3 T A 4: 136,255,143 probably benign Het
Tmem185a C T X: 70,462,186 probably null Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Vmn1r212 A T 13: 22,883,188 V325E unknown Het
Vmn1r35 T A 6: 66,679,073 R204S probably damaging Het
Vmn2r57 A G 7: 41,428,130 M204T probably damaging Het
Wdfy3 A T 5: 101,944,239 Y411* probably null Het
Zfp335 G T 2: 164,910,700 D41E probably damaging Het
Other mutations in Sema6d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Sema6d APN 2 124659865 missense possibly damaging 0.91
IGL00508:Sema6d APN 2 124656924 splice site probably benign
IGL00710:Sema6d APN 2 124662288 missense probably benign 0.00
IGL00811:Sema6d APN 2 124658469 missense probably damaging 1.00
IGL01457:Sema6d APN 2 124653642 missense unknown
IGL01524:Sema6d APN 2 124664075 missense possibly damaging 0.86
IGL01598:Sema6d APN 2 124665098 missense probably damaging 1.00
IGL01915:Sema6d APN 2 124658571 splice site probably benign
IGL02365:Sema6d APN 2 124656868 missense probably benign 0.14
IGL02698:Sema6d APN 2 124653723 missense possibly damaging 0.95
IGL02865:Sema6d APN 2 124664073 missense probably damaging 1.00
IGL03018:Sema6d APN 2 124659600 missense possibly damaging 0.95
IGL03333:Sema6d APN 2 124664370 missense possibly damaging 0.83
R0269:Sema6d UTSW 2 124660745 missense possibly damaging 0.63
R0390:Sema6d UTSW 2 124658490 missense probably damaging 1.00
R0541:Sema6d UTSW 2 124665277 missense probably damaging 1.00
R0615:Sema6d UTSW 2 124654135 splice site probably benign
R0617:Sema6d UTSW 2 124660745 missense possibly damaging 0.63
R0694:Sema6d UTSW 2 124664041 missense probably damaging 1.00
R0854:Sema6d UTSW 2 124665302 missense probably damaging 0.97
R1630:Sema6d UTSW 2 124664345 missense possibly damaging 0.89
R1682:Sema6d UTSW 2 124665149 missense probably benign 0.21
R1823:Sema6d UTSW 2 124659556 splice site probably null
R1932:Sema6d UTSW 2 124659886 critical splice donor site probably null
R2249:Sema6d UTSW 2 124659588 missense possibly damaging 0.54
R2256:Sema6d UTSW 2 124664150 missense probably damaging 1.00
R2331:Sema6d UTSW 2 124658063 missense probably damaging 1.00
R2910:Sema6d UTSW 2 124665037 missense probably damaging 1.00
R3683:Sema6d UTSW 2 124654226 missense possibly damaging 0.88
R4135:Sema6d UTSW 2 124664120 missense probably damaging 0.96
R4446:Sema6d UTSW 2 124664059 missense probably damaging 0.98
R4583:Sema6d UTSW 2 124664162 missense probably damaging 1.00
R4599:Sema6d UTSW 2 124654231 missense probably damaging 1.00
R4822:Sema6d UTSW 2 124662294 missense possibly damaging 0.79
R4884:Sema6d UTSW 2 124656818 splice site probably null
R5288:Sema6d UTSW 2 124664246 missense probably damaging 1.00
R5443:Sema6d UTSW 2 124656836 missense probably damaging 1.00
R5504:Sema6d UTSW 2 124658021 missense probably damaging 1.00
R5534:Sema6d UTSW 2 124659815 missense possibly damaging 0.75
R5615:Sema6d UTSW 2 124656901 missense probably damaging 0.97
R5747:Sema6d UTSW 2 124664947 missense probably damaging 0.99
R5866:Sema6d UTSW 2 124664342 missense probably benign 0.26
R5980:Sema6d UTSW 2 124664708 missense probably damaging 1.00
R6670:Sema6d UTSW 2 124654842 small deletion probably benign
R6803:Sema6d UTSW 2 124664050 missense probably damaging 0.96
R7023:Sema6d UTSW 2 124664911 missense probably damaging 1.00
R7068:Sema6d UTSW 2 124657821 missense probably benign
R7426:Sema6d UTSW 2 124654158 missense probably damaging 1.00
R7556:Sema6d UTSW 2 124654189 missense probably damaging 1.00
R7569:Sema6d UTSW 2 124657972 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGTAGCTCAGTTCGCTGCAG -3'
(R):5'- TGAGCCCTTTGAAACAGCACAG -3'

Sequencing Primer
(F):5'- TAGCTGACTTTAAAGACACGGGCTC -3'
(R):5'- CCCTTTGAAACAGCACAGGAGAG -3'
Posted On2015-04-17