Incidental Mutation 'R3937:Ints3'
ID307211
Institutional Source Beutler Lab
Gene Symbol Ints3
Ensembl Gene ENSMUSG00000027933
Gene Nameintegrator complex subunit 3
Synonyms
MMRRC Submission 040921-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R3937 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location90391388-90433622 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 90403987 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 438 (R438*)
Ref Sequence ENSEMBL: ENSMUSP00000143196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029542] [ENSMUST00000071488] [ENSMUST00000196530]
Predicted Effect probably null
Transcript: ENSMUST00000029542
AA Change: R438*
SMART Domains Protein: ENSMUSP00000029542
Gene: ENSMUSG00000027933
AA Change: R438*

DomainStartEndE-ValueType
low complexity region 11 33 N/A INTRINSIC
Pfam:DUF2356 269 493 6e-110 PFAM
low complexity region 557 568 N/A INTRINSIC
low complexity region 632 647 N/A INTRINSIC
low complexity region 666 678 N/A INTRINSIC
coiled coil region 913 940 N/A INTRINSIC
low complexity region 1006 1019 N/A INTRINSIC
low complexity region 1021 1031 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000071488
AA Change: R438*
SMART Domains Protein: ENSMUSP00000071422
Gene: ENSMUSG00000027933
AA Change: R438*

DomainStartEndE-ValueType
low complexity region 11 33 N/A INTRINSIC
Pfam:DUF2356 269 493 6e-110 PFAM
low complexity region 557 568 N/A INTRINSIC
low complexity region 632 647 N/A INTRINSIC
low complexity region 666 678 N/A INTRINSIC
coiled coil region 913 940 N/A INTRINSIC
low complexity region 1006 1019 N/A INTRINSIC
low complexity region 1021 1031 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000196530
AA Change: R438*
SMART Domains Protein: ENSMUSP00000143196
Gene: ENSMUSG00000027933
AA Change: R438*

DomainStartEndE-ValueType
low complexity region 11 33 N/A INTRINSIC
Pfam:DUF2356 268 497 5.7e-114 PFAM
low complexity region 557 568 N/A INTRINSIC
low complexity region 632 647 N/A INTRINSIC
low complexity region 666 678 N/A INTRINSIC
coiled coil region 913 940 N/A INTRINSIC
low complexity region 1006 1018 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198562
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198776
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199158
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199992
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene can form a complex with human single-strand DNA binding proteins 1 or 2 (hSSB1 and hSSB2) and other proteins to mediate genome stability and the DNA damage response. The encoded protein is also part of a multiprotein complex that interacts with the C-terminal domain of RNA polymerase II large subunit to help regulate processing of U1 and U2 small nuclear RNAs. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T G 4: 147,942,053 S343R possibly damaging Het
Abca8b G T 11: 109,974,567 P355T probably benign Het
Abhd15 T C 11: 77,515,938 V247A probably benign Het
Adamts1 C T 16: 85,795,619 V634M possibly damaging Het
BC049715 T C 6: 136,840,455 I231T possibly damaging Het
Chpf A T 1: 75,477,540 V198E probably damaging Het
Cp C T 3: 19,971,034 P386S probably damaging Het
Cth A G 3: 157,920,040 I107T possibly damaging Het
Ctrc T C 4: 141,840,321 D157G probably damaging Het
D630003M21Rik A G 2: 158,200,360 Y889H probably damaging Het
Elavl3 A G 9: 22,018,744 V288A probably damaging Het
Esyt3 A T 9: 99,336,192 I130K probably benign Het
F13a1 A T 13: 36,916,901 V423D probably damaging Het
Faf1 T C 4: 109,757,692 probably benign Het
Fam227b A T 2: 126,127,060 D31E probably benign Het
Fastkd2 A G 1: 63,737,836 D377G possibly damaging Het
Fbxl6 G A 15: 76,536,624 R384* probably null Het
Fcamr A T 1: 130,804,576 H44L probably damaging Het
Fhod3 A G 18: 25,090,761 N1055D probably benign Het
Garem1 A T 18: 21,148,806 Y164* probably null Het
Gemin4 C T 11: 76,212,888 C349Y probably damaging Het
Gnal A G 18: 67,135,370 probably null Het
Hacl1 T C 14: 31,634,191 probably benign Het
Hectd3 T C 4: 116,998,530 V409A probably benign Het
Hps6 A G 19: 46,004,053 E143G probably damaging Het
Hspa4 T A 11: 53,270,949 I459L probably benign Het
Ighv3-6 G A 12: 114,288,441 Q21* probably null Het
Jmjd6 T C 11: 116,841,165 N237D probably benign Het
Lrrk2 C A 15: 91,778,504 T1912K probably damaging Het
Mdga2 C A 12: 67,221,206 probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Myh6 T C 14: 54,963,055 D203G probably benign Het
Myo5b T C 18: 74,716,037 S1116P probably damaging Het
Nalcn T A 14: 123,369,945 D704V probably benign Het
Nes A T 3: 87,971,236 M12L probably benign Het
Olfr1052 T A 2: 86,298,016 S67T probably damaging Het
Olfr118 A G 17: 37,672,967 T315A probably benign Het
Olfr1328 T C 4: 118,934,683 D53G probably damaging Het
Olfr453 T A 6: 42,744,076 I13N probably damaging Het
Pcdha2 T C 18: 36,941,323 V669A probably benign Het
Pdhx T C 2: 103,022,219 N433S probably damaging Het
Pip5kl1 A G 2: 32,579,112 R261G probably damaging Het
Plekhj1 A G 10: 80,797,775 I76T probably damaging Het
Ppp1r3a A T 6: 14,719,074 S614T probably damaging Het
Ptpru T C 4: 131,774,304 N1207S probably damaging Het
Ranbp2 T C 10: 58,476,472 F1005L probably benign Het
Rims2 A G 15: 39,437,845 E324G probably damaging Het
Sema6d A T 2: 124,656,850 I227L probably benign Het
Smarcad1 T G 6: 65,114,336 L1014V probably damaging Het
Spag9 T C 11: 94,044,417 V18A possibly damaging Het
Spag9 T G 11: 94,044,479 S39A possibly damaging Het
Sun2 T C 15: 79,734,155 K268E probably benign Het
Tbpl2 C T 2: 24,087,139 R289Q probably benign Het
Tcea3 T A 4: 136,255,143 probably benign Het
Tmem185a C T X: 70,462,186 probably null Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Vmn1r212 A T 13: 22,883,188 V325E unknown Het
Vmn1r35 T A 6: 66,679,073 R204S probably damaging Het
Vmn2r57 A G 7: 41,428,130 M204T probably damaging Het
Wdfy3 A T 5: 101,944,239 Y411* probably null Het
Zfp335 G T 2: 164,910,700 D41E probably damaging Het
Other mutations in Ints3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Ints3 APN 3 90406329 missense probably damaging 1.00
IGL01339:Ints3 APN 3 90415156 critical splice donor site probably null
IGL01398:Ints3 APN 3 90392823 missense probably damaging 1.00
IGL01599:Ints3 APN 3 90394322 critical splice donor site probably null
IGL01864:Ints3 APN 3 90415179 missense probably benign 0.33
IGL01984:Ints3 APN 3 90392226 missense possibly damaging 0.79
IGL02325:Ints3 APN 3 90404042 missense probably damaging 1.00
IGL02516:Ints3 APN 3 90403108 missense probably damaging 1.00
IGL02867:Ints3 APN 3 90392836 missense probably damaging 1.00
IGL02889:Ints3 APN 3 90392836 missense probably damaging 1.00
IGL02975:Ints3 APN 3 90401837 splice site probably benign
PIT4431001:Ints3 UTSW 3 90396460 missense probably damaging 0.99
R0003:Ints3 UTSW 3 90408511 missense probably benign 0.00
R0003:Ints3 UTSW 3 90408511 missense probably benign 0.00
R0069:Ints3 UTSW 3 90400647 splice site probably benign
R0069:Ints3 UTSW 3 90400647 splice site probably benign
R1450:Ints3 UTSW 3 90432828 missense probably damaging 1.00
R1985:Ints3 UTSW 3 90400303 critical splice donor site probably null
R2324:Ints3 UTSW 3 90394094 missense probably damaging 1.00
R2425:Ints3 UTSW 3 90394110 missense possibly damaging 0.91
R2920:Ints3 UTSW 3 90393162 missense probably benign 0.22
R4678:Ints3 UTSW 3 90408510 missense possibly damaging 0.47
R4679:Ints3 UTSW 3 90408510 missense possibly damaging 0.47
R4719:Ints3 UTSW 3 90415521 missense probably benign 0.20
R4726:Ints3 UTSW 3 90393777 missense probably damaging 1.00
R4993:Ints3 UTSW 3 90415507 missense probably benign 0.05
R5154:Ints3 UTSW 3 90415561 missense probably benign 0.01
R5243:Ints3 UTSW 3 90401144 frame shift probably null
R5454:Ints3 UTSW 3 90408527 missense possibly damaging 0.72
R5678:Ints3 UTSW 3 90403548 missense probably damaging 0.99
R6123:Ints3 UTSW 3 90413554 missense probably benign 0.01
R6548:Ints3 UTSW 3 90392124 unclassified probably benign
R6916:Ints3 UTSW 3 90406334 missense probably damaging 1.00
R7265:Ints3 UTSW 3 90403983 critical splice donor site probably null
R7332:Ints3 UTSW 3 90415512 missense probably damaging 0.98
R7699:Ints3 UTSW 3 90421804 missense probably benign 0.00
R7700:Ints3 UTSW 3 90421804 missense probably benign 0.00
R7790:Ints3 UTSW 3 90400413 missense probably benign 0.09
R7827:Ints3 UTSW 3 90424012 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- AGAATCCTTGGACTGGACCC -3'
(R):5'- TAGACCCAGAACTTCCTAGGG -3'

Sequencing Primer
(F):5'- GGACCCAGTTGTTCCTCAAATAC -3'
(R):5'- AGAACTTCCTAGGGGCTTCAC -3'
Posted On2015-04-17