Incidental Mutation 'R3937:Cth'
ID 307212
Institutional Source Beutler Lab
Gene Symbol Cth
Ensembl Gene ENSMUSG00000028179
Gene Name cystathionase (cystathionine gamma-lyase)
Synonyms CSE, 0610010I13Rik
MMRRC Submission 040921-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R3937 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 157894248-157925077 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 157920040 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 107 (I107T)
Ref Sequence ENSEMBL: ENSMUSP00000113672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118539]
AlphaFold Q8VCN5
Predicted Effect possibly damaging
Transcript: ENSMUST00000118539
AA Change: I107T

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113672
Gene: ENSMUSG00000028179
AA Change: I107T

DomainStartEndE-ValueType
Pfam:Cys_Met_Meta_PP 18 394 5.8e-157 PFAM
Pfam:Aminotran_1_2 32 235 4.3e-9 PFAM
Pfam:DegT_DnrJ_EryC1 53 246 1.9e-7 PFAM
Pfam:Aminotran_5 68 232 4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125028
Meta Mutation Damage Score 0.8921 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic enzyme in the trans-sulfuration pathway that converts cystathione derived from methionine into cysteine. Glutathione synthesis in the liver is dependent upon the availability of cysteine. Mutations in this gene cause cystathioninuria. Alternative splicing of this gene results in three transcript variants encoding different isoforms. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit hypertension associated with impaired endothelium-dependent vasorelaxation. Mice homozygous for another knock-out allele exhibit normal blood pressure but sensitivty to a low cysteine diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T G 4: 147,942,053 S343R possibly damaging Het
Abca8b G T 11: 109,974,567 P355T probably benign Het
Abhd15 T C 11: 77,515,938 V247A probably benign Het
Adamts1 C T 16: 85,795,619 V634M possibly damaging Het
BC049715 T C 6: 136,840,455 I231T possibly damaging Het
Chpf A T 1: 75,477,540 V198E probably damaging Het
Cp C T 3: 19,971,034 P386S probably damaging Het
Ctrc T C 4: 141,840,321 D157G probably damaging Het
D630003M21Rik A G 2: 158,200,360 Y889H probably damaging Het
Elavl3 A G 9: 22,018,744 V288A probably damaging Het
Esyt3 A T 9: 99,336,192 I130K probably benign Het
F13a1 A T 13: 36,916,901 V423D probably damaging Het
Faf1 T C 4: 109,757,692 probably benign Het
Fam227b A T 2: 126,127,060 D31E probably benign Het
Fastkd2 A G 1: 63,737,836 D377G possibly damaging Het
Fbxl6 G A 15: 76,536,624 R384* probably null Het
Fcamr A T 1: 130,804,576 H44L probably damaging Het
Fhod3 A G 18: 25,090,761 N1055D probably benign Het
Garem1 A T 18: 21,148,806 Y164* probably null Het
Gemin4 C T 11: 76,212,888 C349Y probably damaging Het
Gnal A G 18: 67,135,370 probably null Het
Hacl1 T C 14: 31,634,191 probably benign Het
Hectd3 T C 4: 116,998,530 V409A probably benign Het
Hps6 A G 19: 46,004,053 E143G probably damaging Het
Hspa4 T A 11: 53,270,949 I459L probably benign Het
Ighv3-6 G A 12: 114,288,441 Q21* probably null Het
Ints3 G A 3: 90,403,987 R438* probably null Het
Jmjd6 T C 11: 116,841,165 N237D probably benign Het
Lrrk2 C A 15: 91,778,504 T1912K probably damaging Het
Mdga2 C A 12: 67,221,206 probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Myh6 T C 14: 54,963,055 D203G probably benign Het
Myo5b T C 18: 74,716,037 S1116P probably damaging Het
Nalcn T A 14: 123,369,945 D704V probably benign Het
Nes A T 3: 87,971,236 M12L probably benign Het
Olfr1052 T A 2: 86,298,016 S67T probably damaging Het
Olfr118 A G 17: 37,672,967 T315A probably benign Het
Olfr1328 T C 4: 118,934,683 D53G probably damaging Het
Olfr453 T A 6: 42,744,076 I13N probably damaging Het
Pcdha2 T C 18: 36,941,323 V669A probably benign Het
Pdhx T C 2: 103,022,219 N433S probably damaging Het
Pip5kl1 A G 2: 32,579,112 R261G probably damaging Het
Plekhj1 A G 10: 80,797,775 I76T probably damaging Het
Ppp1r3a A T 6: 14,719,074 S614T probably damaging Het
Ptpru T C 4: 131,774,304 N1207S probably damaging Het
Ranbp2 T C 10: 58,476,472 F1005L probably benign Het
Rims2 A G 15: 39,437,845 E324G probably damaging Het
Sema6d A T 2: 124,656,850 I227L probably benign Het
Smarcad1 T G 6: 65,114,336 L1014V probably damaging Het
Spag9 T C 11: 94,044,417 V18A possibly damaging Het
Spag9 T G 11: 94,044,479 S39A possibly damaging Het
Sun2 T C 15: 79,734,155 K268E probably benign Het
Tbpl2 C T 2: 24,087,139 R289Q probably benign Het
Tcea3 T A 4: 136,255,143 probably benign Het
Tmem185a C T X: 70,462,186 probably null Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Vmn1r212 A T 13: 22,883,188 V325E unknown Het
Vmn1r35 T A 6: 66,679,073 R204S probably damaging Het
Vmn2r57 A G 7: 41,428,130 M204T probably damaging Het
Wdfy3 A T 5: 101,944,239 Y411* probably null Het
Zfp335 G T 2: 164,910,700 D41E probably damaging Het
Other mutations in Cth
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01462:Cth APN 3 157905167 missense probably damaging 0.99
IGL01744:Cth APN 3 157924935 missense probably benign
IGL03128:Cth APN 3 157921035 missense probably damaging 1.00
R0477:Cth UTSW 3 157905175 missense probably damaging 1.00
R0659:Cth UTSW 3 157920115 splice site probably benign
R1699:Cth UTSW 3 157907436 missense probably damaging 1.00
R1724:Cth UTSW 3 157913727 missense probably damaging 1.00
R1744:Cth UTSW 3 157906268 missense probably damaging 0.99
R3822:Cth UTSW 3 157918499 missense probably benign 0.27
R3982:Cth UTSW 3 157913697 nonsense probably null
R4342:Cth UTSW 3 157924976 missense probably damaging 1.00
R5436:Cth UTSW 3 157894826 missense probably benign
R7466:Cth UTSW 3 157924885 missense probably benign 0.05
R8348:Cth UTSW 3 157925020 missense probably benign 0.19
R8448:Cth UTSW 3 157925020 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- GAAGGCTGAACAAGTCCCAC -3'
(R):5'- CCTCAGAGGAGTAGTAGCAGTG -3'

Sequencing Primer
(F):5'- GTCTTCTAGGTACTTCTGGAACACAG -3'
(R):5'- TGGGGAACTGCAGTGGTAC -3'
Posted On 2015-04-17