Incidental Mutation 'R3937:Faf1'
ID307213
Institutional Source Beutler Lab
Gene Symbol Faf1
Ensembl Gene ENSMUSG00000010517
Gene NameFas-associated factor 1
SynonymsDffrx, Fam
MMRRC Submission 040921-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3937 (G1)
Quality Score180
Status Validated
Chromosome4
Chromosomal Location109676588-109963960 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 109757692 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102724]
Predicted Effect probably benign
Transcript: ENSMUST00000102724
SMART Domains Protein: ENSMUSP00000099785
Gene: ENSMUSG00000010517

DomainStartEndE-ValueType
Pfam:UBA_4 8 43 2.5e-10 PFAM
low complexity region 68 82 N/A INTRINSIC
internal_repeat_1 109 155 3.24e-5 PROSPERO
low complexity region 174 180 N/A INTRINSIC
internal_repeat_1 204 250 3.24e-5 PROSPERO
UAS 335 480 3.79e-69 SMART
coiled coil region 496 560 N/A INTRINSIC
UBX 565 647 2.32e-33 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120597
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interaction of Fas ligand (TNFSF6) with the FAS antigen (TNFRSF6) mediates programmed cell death, also called apoptosis, in a number of organ systems. The protein encoded by this gene binds to FAS antigen and can initiate apoptosis or enhance apoptosis initiated through FAS antigen. Initiation of apoptosis by the protein encoded by this gene requires a ubiquitin-like domain but not the FAS-binding domain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous fail to develop beyond 2-cell stage. Mice homozygous for a hypomorphic gene trap allele exhibit decreased susceptibility to dopaminergic neuron neurotoxicity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T G 4: 147,942,053 S343R possibly damaging Het
Abca8b G T 11: 109,974,567 P355T probably benign Het
Abhd15 T C 11: 77,515,938 V247A probably benign Het
Adamts1 C T 16: 85,795,619 V634M possibly damaging Het
BC049715 T C 6: 136,840,455 I231T possibly damaging Het
Chpf A T 1: 75,477,540 V198E probably damaging Het
Cp C T 3: 19,971,034 P386S probably damaging Het
Cth A G 3: 157,920,040 I107T possibly damaging Het
Ctrc T C 4: 141,840,321 D157G probably damaging Het
D630003M21Rik A G 2: 158,200,360 Y889H probably damaging Het
Elavl3 A G 9: 22,018,744 V288A probably damaging Het
Esyt3 A T 9: 99,336,192 I130K probably benign Het
F13a1 A T 13: 36,916,901 V423D probably damaging Het
Fam227b A T 2: 126,127,060 D31E probably benign Het
Fastkd2 A G 1: 63,737,836 D377G possibly damaging Het
Fbxl6 G A 15: 76,536,624 R384* probably null Het
Fcamr A T 1: 130,804,576 H44L probably damaging Het
Fhod3 A G 18: 25,090,761 N1055D probably benign Het
Garem1 A T 18: 21,148,806 Y164* probably null Het
Gemin4 C T 11: 76,212,888 C349Y probably damaging Het
Gnal A G 18: 67,135,370 probably null Het
Hacl1 T C 14: 31,634,191 probably benign Het
Hectd3 T C 4: 116,998,530 V409A probably benign Het
Hps6 A G 19: 46,004,053 E143G probably damaging Het
Hspa4 T A 11: 53,270,949 I459L probably benign Het
Ighv3-6 G A 12: 114,288,441 Q21* probably null Het
Ints3 G A 3: 90,403,987 R438* probably null Het
Jmjd6 T C 11: 116,841,165 N237D probably benign Het
Lrrk2 C A 15: 91,778,504 T1912K probably damaging Het
Mdga2 C A 12: 67,221,206 probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Myh6 T C 14: 54,963,055 D203G probably benign Het
Myo5b T C 18: 74,716,037 S1116P probably damaging Het
Nalcn T A 14: 123,369,945 D704V probably benign Het
Nes A T 3: 87,971,236 M12L probably benign Het
Olfr1052 T A 2: 86,298,016 S67T probably damaging Het
Olfr118 A G 17: 37,672,967 T315A probably benign Het
Olfr1328 T C 4: 118,934,683 D53G probably damaging Het
Olfr453 T A 6: 42,744,076 I13N probably damaging Het
Pcdha2 T C 18: 36,941,323 V669A probably benign Het
Pdhx T C 2: 103,022,219 N433S probably damaging Het
Pip5kl1 A G 2: 32,579,112 R261G probably damaging Het
Plekhj1 A G 10: 80,797,775 I76T probably damaging Het
Ppp1r3a A T 6: 14,719,074 S614T probably damaging Het
Ptpru T C 4: 131,774,304 N1207S probably damaging Het
Ranbp2 T C 10: 58,476,472 F1005L probably benign Het
Rims2 A G 15: 39,437,845 E324G probably damaging Het
Sema6d A T 2: 124,656,850 I227L probably benign Het
Smarcad1 T G 6: 65,114,336 L1014V probably damaging Het
Spag9 T C 11: 94,044,417 V18A possibly damaging Het
Spag9 T G 11: 94,044,479 S39A possibly damaging Het
Sun2 T C 15: 79,734,155 K268E probably benign Het
Tbpl2 C T 2: 24,087,139 R289Q probably benign Het
Tcea3 T A 4: 136,255,143 probably benign Het
Tmem185a C T X: 70,462,186 probably null Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Vmn1r212 A T 13: 22,883,188 V325E unknown Het
Vmn1r35 T A 6: 66,679,073 R204S probably damaging Het
Vmn2r57 A G 7: 41,428,130 M204T probably damaging Het
Wdfy3 A T 5: 101,944,239 Y411* probably null Het
Zfp335 G T 2: 164,910,700 D41E probably damaging Het
Other mutations in Faf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Faf1 APN 4 109840381 missense probably benign 0.10
IGL00569:Faf1 APN 4 109961880 makesense probably null
IGL01398:Faf1 APN 4 109736596 missense probably damaging 0.99
IGL01640:Faf1 APN 4 109840403 missense probably damaging 1.00
IGL01739:Faf1 APN 4 109677081 splice site probably benign
IGL02265:Faf1 APN 4 109742904 missense probably benign 0.00
IGL02372:Faf1 APN 4 109935582 missense probably benign 0.17
IGL02999:Faf1 APN 4 109861893 missense probably benign 0.01
R0058:Faf1 UTSW 4 109736624 missense probably benign 0.00
R0058:Faf1 UTSW 4 109736624 missense probably benign 0.00
R0098:Faf1 UTSW 4 109935499 missense probably damaging 0.99
R0098:Faf1 UTSW 4 109935499 missense probably damaging 0.99
R0183:Faf1 UTSW 4 109935610 missense probably benign
R0463:Faf1 UTSW 4 109890941 missense probably benign 0.02
R0505:Faf1 UTSW 4 109840403 missense possibly damaging 0.91
R0755:Faf1 UTSW 4 109961839 missense probably benign 0.00
R1705:Faf1 UTSW 4 109677002 start gained probably benign
R2061:Faf1 UTSW 4 109710808 missense probably damaging 1.00
R2132:Faf1 UTSW 4 109710845 missense probably damaging 1.00
R2133:Faf1 UTSW 4 109710845 missense probably damaging 1.00
R2696:Faf1 UTSW 4 109841328 missense possibly damaging 0.92
R3939:Faf1 UTSW 4 109861879 missense probably damaging 1.00
R4602:Faf1 UTSW 4 109727428 missense probably benign
R4727:Faf1 UTSW 4 109840367 missense probably damaging 0.96
R4860:Faf1 UTSW 4 109742896 missense probably damaging 0.99
R4860:Faf1 UTSW 4 109742896 missense probably damaging 0.99
R4896:Faf1 UTSW 4 109842299 missense probably benign 0.02
R4913:Faf1 UTSW 4 109935549 missense possibly damaging 0.96
R5688:Faf1 UTSW 4 109794813 missense probably damaging 1.00
R5721:Faf1 UTSW 4 109935666 missense probably benign 0.34
R5905:Faf1 UTSW 4 109890929 missense probably benign 0.03
R6190:Faf1 UTSW 4 109861815 missense probably damaging 0.97
R6364:Faf1 UTSW 4 109961800 missense possibly damaging 0.46
R6454:Faf1 UTSW 4 109842334 missense probably benign 0.27
R6805:Faf1 UTSW 4 109861852 missense probably damaging 1.00
R7101:Faf1 UTSW 4 109925956 missense probably benign 0.12
R7381:Faf1 UTSW 4 109861937 missense probably damaging 0.99
R7392:Faf1 UTSW 4 109794843 missense probably benign 0.01
R7584:Faf1 UTSW 4 109925957 missense probably damaging 0.99
R7660:Faf1 UTSW 4 109861837 missense probably damaging 0.98
R7678:Faf1 UTSW 4 109829864 missense probably benign 0.00
R7715:Faf1 UTSW 4 109710814 missense probably damaging 0.99
R7721:Faf1 UTSW 4 109736597 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAACATTGGGCCCGGACATG -3'
(R):5'- AGAGCTCCCACTTACAACATTTG -3'

Sequencing Primer
(F):5'- TGCAGCTAGCTGTGAAGC -3'
(R):5'- GCTCCCACTTACAACATTTGTATTTC -3'
Posted On2015-04-17