Incidental Mutation 'R3937:Tcea3'
ID 307217
Institutional Source Beutler Lab
Gene Symbol Tcea3
Ensembl Gene ENSMUSG00000001604
Gene Name transcription elongation factor A (SII), 3
Synonyms S-II
MMRRC Submission 040921-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock # R3937 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 136247729-136274898 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 136255143 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102533] [ENSMUST00000143942]
AlphaFold P23881
Predicted Effect probably benign
Transcript: ENSMUST00000102533
SMART Domains Protein: ENSMUSP00000099592
Gene: ENSMUSG00000001604

DomainStartEndE-ValueType
TFS2N 7 81 1.43e-29 SMART
low complexity region 86 100 N/A INTRINSIC
low complexity region 124 144 N/A INTRINSIC
low complexity region 157 168 N/A INTRINSIC
TFS2M 184 285 1.05e-52 SMART
ZnF_C2C2 307 346 6.87e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136812
Predicted Effect probably benign
Transcript: ENSMUST00000143942
SMART Domains Protein: ENSMUSP00000122718
Gene: ENSMUSG00000001604

DomainStartEndE-ValueType
TFS2N 7 81 1.41e-28 SMART
low complexity region 110 124 N/A INTRINSIC
low complexity region 148 168 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T G 4: 147,942,053 S343R possibly damaging Het
Abca8b G T 11: 109,974,567 P355T probably benign Het
Abhd15 T C 11: 77,515,938 V247A probably benign Het
Adamts1 C T 16: 85,795,619 V634M possibly damaging Het
BC049715 T C 6: 136,840,455 I231T possibly damaging Het
Chpf A T 1: 75,477,540 V198E probably damaging Het
Cp C T 3: 19,971,034 P386S probably damaging Het
Cth A G 3: 157,920,040 I107T possibly damaging Het
Ctrc T C 4: 141,840,321 D157G probably damaging Het
D630003M21Rik A G 2: 158,200,360 Y889H probably damaging Het
Elavl3 A G 9: 22,018,744 V288A probably damaging Het
Esyt3 A T 9: 99,336,192 I130K probably benign Het
F13a1 A T 13: 36,916,901 V423D probably damaging Het
Faf1 T C 4: 109,757,692 probably benign Het
Fam227b A T 2: 126,127,060 D31E probably benign Het
Fastkd2 A G 1: 63,737,836 D377G possibly damaging Het
Fbxl6 G A 15: 76,536,624 R384* probably null Het
Fcamr A T 1: 130,804,576 H44L probably damaging Het
Fhod3 A G 18: 25,090,761 N1055D probably benign Het
Garem1 A T 18: 21,148,806 Y164* probably null Het
Gemin4 C T 11: 76,212,888 C349Y probably damaging Het
Gnal A G 18: 67,135,370 probably null Het
Hacl1 T C 14: 31,634,191 probably benign Het
Hectd3 T C 4: 116,998,530 V409A probably benign Het
Hps6 A G 19: 46,004,053 E143G probably damaging Het
Hspa4 T A 11: 53,270,949 I459L probably benign Het
Ighv3-6 G A 12: 114,288,441 Q21* probably null Het
Ints3 G A 3: 90,403,987 R438* probably null Het
Jmjd6 T C 11: 116,841,165 N237D probably benign Het
Lrrk2 C A 15: 91,778,504 T1912K probably damaging Het
Mdga2 C A 12: 67,221,206 probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Myh6 T C 14: 54,963,055 D203G probably benign Het
Myo5b T C 18: 74,716,037 S1116P probably damaging Het
Nalcn T A 14: 123,369,945 D704V probably benign Het
Nes A T 3: 87,971,236 M12L probably benign Het
Olfr1052 T A 2: 86,298,016 S67T probably damaging Het
Olfr118 A G 17: 37,672,967 T315A probably benign Het
Olfr1328 T C 4: 118,934,683 D53G probably damaging Het
Olfr453 T A 6: 42,744,076 I13N probably damaging Het
Pcdha2 T C 18: 36,941,323 V669A probably benign Het
Pdhx T C 2: 103,022,219 N433S probably damaging Het
Pip5kl1 A G 2: 32,579,112 R261G probably damaging Het
Plekhj1 A G 10: 80,797,775 I76T probably damaging Het
Ppp1r3a A T 6: 14,719,074 S614T probably damaging Het
Ptpru T C 4: 131,774,304 N1207S probably damaging Het
Ranbp2 T C 10: 58,476,472 F1005L probably benign Het
Rims2 A G 15: 39,437,845 E324G probably damaging Het
Sema6d A T 2: 124,656,850 I227L probably benign Het
Smarcad1 T G 6: 65,114,336 L1014V probably damaging Het
Spag9 T C 11: 94,044,417 V18A possibly damaging Het
Spag9 T G 11: 94,044,479 S39A possibly damaging Het
Sun2 T C 15: 79,734,155 K268E probably benign Het
Tbpl2 C T 2: 24,087,139 R289Q probably benign Het
Tmem185a C T X: 70,462,186 probably null Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Vmn1r212 A T 13: 22,883,188 V325E unknown Het
Vmn1r35 T A 6: 66,679,073 R204S probably damaging Het
Vmn2r57 A G 7: 41,428,130 M204T probably damaging Het
Wdfy3 A T 5: 101,944,239 Y411* probably null Het
Zfp335 G T 2: 164,910,700 D41E probably damaging Het
Other mutations in Tcea3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Tcea3 APN 4 136273692 missense probably damaging 1.00
IGL01647:Tcea3 APN 4 136274776 splice site probably benign
IGL02153:Tcea3 APN 4 136273634 splice site probably benign
IGL02832:Tcea3 APN 4 136268113 missense probably damaging 1.00
IGL02951:Tcea3 APN 4 136257988 critical splice donor site probably null
R0281:Tcea3 UTSW 4 136271366 missense probably damaging 1.00
R0646:Tcea3 UTSW 4 136248071 nonsense probably null
R4944:Tcea3 UTSW 4 136268093 missense probably damaging 1.00
R5028:Tcea3 UTSW 4 136257935 missense possibly damaging 0.87
R5169:Tcea3 UTSW 4 136264870 critical splice acceptor site probably null
R5245:Tcea3 UTSW 4 136264502 missense probably benign 0.01
R5511:Tcea3 UTSW 4 136271372 missense probably damaging 1.00
R5730:Tcea3 UTSW 4 136264893 missense probably benign 0.00
R6208:Tcea3 UTSW 4 136248049 start codon destroyed probably damaging 0.96
R7106:Tcea3 UTSW 4 136271368 missense probably damaging 1.00
R8018:Tcea3 UTSW 4 136257918 splice site probably benign
R8076:Tcea3 UTSW 4 136268129 missense probably damaging 1.00
R8078:Tcea3 UTSW 4 136254514 missense probably damaging 0.99
R8158:Tcea3 UTSW 4 136273716 critical splice donor site probably null
R8861:Tcea3 UTSW 4 136254499 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGATGGGTGTACTGCTATGTTCC -3'
(R):5'- TATGACAGGCATGGTCCGTC -3'

Sequencing Primer
(F):5'- TGCATATATGTGTGCATGCAC -3'
(R):5'- TCCAGCCCTAGAAAGAAG -3'
Posted On 2015-04-17