Incidental Mutation 'R3937:Esyt3'
ID307229
Institutional Source Beutler Lab
Gene Symbol Esyt3
Ensembl Gene ENSMUSG00000037681
Gene Nameextended synaptotagmin-like protein 3
SynonymsFam62c, D9Ertd280e
MMRRC Submission 040921-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3937 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location99309963-99358557 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 99336192 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 130 (I130K)
Ref Sequence ENSEMBL: ENSMUSP00000038757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042158]
Predicted Effect probably benign
Transcript: ENSMUST00000042158
AA Change: I130K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000038757
Gene: ENSMUSG00000037681
AA Change: I130K

DomainStartEndE-ValueType
transmembrane domain 54 76 N/A INTRINSIC
Pfam:SMP_LBD 118 295 3.7e-63 PFAM
C2 311 411 9.23e-20 SMART
low complexity region 422 432 N/A INTRINSIC
C2 449 563 6.6e-7 SMART
low complexity region 658 673 N/A INTRINSIC
low complexity region 729 739 N/A INTRINSIC
C2 775 880 4.91e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187365
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (60/60)
MGI Phenotype PHENOTYPE: Mice are viable and fertile without overt morphological defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T G 4: 147,942,053 S343R possibly damaging Het
Abca8b G T 11: 109,974,567 P355T probably benign Het
Abhd15 T C 11: 77,515,938 V247A probably benign Het
Adamts1 C T 16: 85,795,619 V634M possibly damaging Het
BC049715 T C 6: 136,840,455 I231T possibly damaging Het
Chpf A T 1: 75,477,540 V198E probably damaging Het
Cp C T 3: 19,971,034 P386S probably damaging Het
Cth A G 3: 157,920,040 I107T possibly damaging Het
Ctrc T C 4: 141,840,321 D157G probably damaging Het
D630003M21Rik A G 2: 158,200,360 Y889H probably damaging Het
Elavl3 A G 9: 22,018,744 V288A probably damaging Het
F13a1 A T 13: 36,916,901 V423D probably damaging Het
Faf1 T C 4: 109,757,692 probably benign Het
Fam227b A T 2: 126,127,060 D31E probably benign Het
Fastkd2 A G 1: 63,737,836 D377G possibly damaging Het
Fbxl6 G A 15: 76,536,624 R384* probably null Het
Fcamr A T 1: 130,804,576 H44L probably damaging Het
Fhod3 A G 18: 25,090,761 N1055D probably benign Het
Garem1 A T 18: 21,148,806 Y164* probably null Het
Gemin4 C T 11: 76,212,888 C349Y probably damaging Het
Gnal A G 18: 67,135,370 probably null Het
Hacl1 T C 14: 31,634,191 probably benign Het
Hectd3 T C 4: 116,998,530 V409A probably benign Het
Hps6 A G 19: 46,004,053 E143G probably damaging Het
Hspa4 T A 11: 53,270,949 I459L probably benign Het
Ighv3-6 G A 12: 114,288,441 Q21* probably null Het
Ints3 G A 3: 90,403,987 R438* probably null Het
Jmjd6 T C 11: 116,841,165 N237D probably benign Het
Lrrk2 C A 15: 91,778,504 T1912K probably damaging Het
Mdga2 C A 12: 67,221,206 probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Myh6 T C 14: 54,963,055 D203G probably benign Het
Myo5b T C 18: 74,716,037 S1116P probably damaging Het
Nalcn T A 14: 123,369,945 D704V probably benign Het
Nes A T 3: 87,971,236 M12L probably benign Het
Olfr1052 T A 2: 86,298,016 S67T probably damaging Het
Olfr118 A G 17: 37,672,967 T315A probably benign Het
Olfr1328 T C 4: 118,934,683 D53G probably damaging Het
Olfr453 T A 6: 42,744,076 I13N probably damaging Het
Pcdha2 T C 18: 36,941,323 V669A probably benign Het
Pdhx T C 2: 103,022,219 N433S probably damaging Het
Pip5kl1 A G 2: 32,579,112 R261G probably damaging Het
Plekhj1 A G 10: 80,797,775 I76T probably damaging Het
Ppp1r3a A T 6: 14,719,074 S614T probably damaging Het
Ptpru T C 4: 131,774,304 N1207S probably damaging Het
Ranbp2 T C 10: 58,476,472 F1005L probably benign Het
Rims2 A G 15: 39,437,845 E324G probably damaging Het
Sema6d A T 2: 124,656,850 I227L probably benign Het
Smarcad1 T G 6: 65,114,336 L1014V probably damaging Het
Spag9 T C 11: 94,044,417 V18A possibly damaging Het
Spag9 T G 11: 94,044,479 S39A possibly damaging Het
Sun2 T C 15: 79,734,155 K268E probably benign Het
Tbpl2 C T 2: 24,087,139 R289Q probably benign Het
Tcea3 T A 4: 136,255,143 probably benign Het
Tmem185a C T X: 70,462,186 probably null Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Vmn1r212 A T 13: 22,883,188 V325E unknown Het
Vmn1r35 T A 6: 66,679,073 R204S probably damaging Het
Vmn2r57 A G 7: 41,428,130 M204T probably damaging Het
Wdfy3 A T 5: 101,944,239 Y411* probably null Het
Zfp335 G T 2: 164,910,700 D41E probably damaging Het
Other mutations in Esyt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02576:Esyt3 APN 9 99315225 missense probably benign 0.07
IGL02596:Esyt3 APN 9 99328015 missense probably benign 0.02
IGL02716:Esyt3 APN 9 99317224 missense probably damaging 1.00
IGL02836:Esyt3 APN 9 99320907 splice site probably benign
IGL03372:Esyt3 APN 9 99336056 splice site probably benign
R0008:Esyt3 UTSW 9 99338807 missense possibly damaging 0.89
R1217:Esyt3 UTSW 9 99318044 missense possibly damaging 0.92
R1395:Esyt3 UTSW 9 99316782 unclassified probably benign
R1478:Esyt3 UTSW 9 99318066 missense probably benign 0.03
R1710:Esyt3 UTSW 9 99336191 missense probably benign
R1792:Esyt3 UTSW 9 99358116 nonsense probably null
R1913:Esyt3 UTSW 9 99320311 missense probably benign 0.00
R3792:Esyt3 UTSW 9 99315281 missense possibly damaging 0.93
R3793:Esyt3 UTSW 9 99315281 missense possibly damaging 0.93
R3964:Esyt3 UTSW 9 99320322 missense probably damaging 1.00
R3965:Esyt3 UTSW 9 99320322 missense probably damaging 1.00
R4061:Esyt3 UTSW 9 99320838 missense probably damaging 1.00
R4088:Esyt3 UTSW 9 99324237 missense probably benign
R4436:Esyt3 UTSW 9 99358025 intron probably benign
R5274:Esyt3 UTSW 9 99318297 missense probably benign
R5590:Esyt3 UTSW 9 99358413 utr 5 prime probably benign
R5705:Esyt3 UTSW 9 99318207 missense probably benign 0.00
R6543:Esyt3 UTSW 9 99338772 missense possibly damaging 0.77
R6738:Esyt3 UTSW 9 99320293 missense probably damaging 0.98
R7000:Esyt3 UTSW 9 99322153 missense probably damaging 0.99
R7019:Esyt3 UTSW 9 99315285 missense probably benign 0.11
R7104:Esyt3 UTSW 9 99338787 missense probably damaging 1.00
R7130:Esyt3 UTSW 9 99318170 missense probably benign
R7141:Esyt3 UTSW 9 99321440 missense probably benign 0.12
R7145:Esyt3 UTSW 9 99319574 missense probably damaging 1.00
R7447:Esyt3 UTSW 9 99321562 missense probably damaging 1.00
R7459:Esyt3 UTSW 9 99358064 missense probably benign 0.00
R7767:Esyt3 UTSW 9 99324971 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGGAGAAAAGACTGCCCTGC -3'
(R):5'- ATGGTACCCTGCAAAGTGC -3'

Sequencing Primer
(F):5'- TGCAAGTCCAGGCTGACCTC -3'
(R):5'- AAGTGCACCTCAGCCTCTG -3'
Posted On2015-04-17