Incidental Mutation 'R3937:Plekhj1'
ID307233
Institutional Source Beutler Lab
Gene Symbol Plekhj1
Ensembl Gene ENSMUSG00000035278
Gene Namepleckstrin homology domain containing, family J member 1
Synonyms9530063M10Rik
MMRRC Submission 040921-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R3937 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location80796099-80798626 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80797775 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 76 (I76T)
Ref Sequence ENSEMBL: ENSMUSP00000042334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036805] [ENSMUST00000105336] [ENSMUST00000127740] [ENSMUST00000147440] [ENSMUST00000148665] [ENSMUST00000149394] [ENSMUST00000150338] [ENSMUST00000151928] [ENSMUST00000218209] [ENSMUST00000219378] [ENSMUST00000219959]
Predicted Effect probably damaging
Transcript: ENSMUST00000036805
AA Change: I76T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000042334
Gene: ENSMUSG00000035278
AA Change: I76T

DomainStartEndE-ValueType
PH 16 110 1.48e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105336
SMART Domains Protein: ENSMUSP00000100973
Gene: ENSMUSG00000061589

DomainStartEndE-ValueType
Pfam:DOT1 115 317 9.4e-86 PFAM
low complexity region 335 348 N/A INTRINSIC
AT_hook 407 419 4.64e-1 SMART
low complexity region 437 447 N/A INTRINSIC
coiled coil region 558 647 N/A INTRINSIC
low complexity region 917 936 N/A INTRINSIC
low complexity region 948 961 N/A INTRINSIC
low complexity region 1084 1095 N/A INTRINSIC
low complexity region 1145 1157 N/A INTRINSIC
low complexity region 1186 1198 N/A INTRINSIC
low complexity region 1436 1446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127740
Predicted Effect probably benign
Transcript: ENSMUST00000138505
SMART Domains Protein: ENSMUSP00000119492
Gene: ENSMUSG00000061589

DomainStartEndE-ValueType
low complexity region 24 43 N/A INTRINSIC
low complexity region 52 64 N/A INTRINSIC
low complexity region 73 87 N/A INTRINSIC
low complexity region 92 137 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139461
Predicted Effect probably benign
Transcript: ENSMUST00000147440
SMART Domains Protein: ENSMUSP00000116478
Gene: ENSMUSG00000020211

DomainStartEndE-ValueType
low complexity region 18 36 N/A INTRINSIC
Blast:CactinC_cactus 41 67 1e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148665
SMART Domains Protein: ENSMUSP00000117160
Gene: ENSMUSG00000020211

DomainStartEndE-ValueType
low complexity region 18 36 N/A INTRINSIC
ZnF_U1 51 85 5.02e-9 SMART
ZnF_C2H2 54 78 1.23e1 SMART
CactinC_cactus 91 219 8.29e-35 SMART
low complexity region 300 318 N/A INTRINSIC
low complexity region 320 420 N/A INTRINSIC
low complexity region 423 452 N/A INTRINSIC
low complexity region 459 484 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149394
SMART Domains Protein: ENSMUSP00000127762
Gene: ENSMUSG00000061589

DomainStartEndE-ValueType
low complexity region 24 36 N/A INTRINSIC
low complexity region 65 77 N/A INTRINSIC
low complexity region 315 325 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150338
SMART Domains Protein: ENSMUSP00000116581
Gene: ENSMUSG00000061589

DomainStartEndE-ValueType
Pfam:DOT1 1 100 3.4e-37 PFAM
low complexity region 118 131 N/A INTRINSIC
AT_hook 190 202 4.64e-1 SMART
low complexity region 220 230 N/A INTRINSIC
low complexity region 371 390 N/A INTRINSIC
SCOP:d1fxkc_ 396 441 1e-3 SMART
low complexity region 700 719 N/A INTRINSIC
low complexity region 731 744 N/A INTRINSIC
low complexity region 867 878 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
low complexity region 969 981 N/A INTRINSIC
low complexity region 1020 1032 N/A INTRINSIC
low complexity region 1041 1055 N/A INTRINSIC
low complexity region 1060 1105 N/A INTRINSIC
low complexity region 1157 1174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151928
SMART Domains Protein: ENSMUSP00000114164
Gene: ENSMUSG00000020211

DomainStartEndE-ValueType
low complexity region 18 36 N/A INTRINSIC
ZnF_U1 51 85 5.02e-9 SMART
ZnF_C2H2 54 78 1.23e1 SMART
CactinC_cactus 91 194 1.26e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217735
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218036
Predicted Effect probably benign
Transcript: ENSMUST00000218209
Predicted Effect silent
Transcript: ENSMUST00000219378
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219767
Predicted Effect probably benign
Transcript: ENSMUST00000219959
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220093
Meta Mutation Damage Score 0.7386 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T G 4: 147,942,053 S343R possibly damaging Het
Abca8b G T 11: 109,974,567 P355T probably benign Het
Abhd15 T C 11: 77,515,938 V247A probably benign Het
Adamts1 C T 16: 85,795,619 V634M possibly damaging Het
BC049715 T C 6: 136,840,455 I231T possibly damaging Het
Chpf A T 1: 75,477,540 V198E probably damaging Het
Cp C T 3: 19,971,034 P386S probably damaging Het
Cth A G 3: 157,920,040 I107T possibly damaging Het
Ctrc T C 4: 141,840,321 D157G probably damaging Het
D630003M21Rik A G 2: 158,200,360 Y889H probably damaging Het
Elavl3 A G 9: 22,018,744 V288A probably damaging Het
Esyt3 A T 9: 99,336,192 I130K probably benign Het
F13a1 A T 13: 36,916,901 V423D probably damaging Het
Faf1 T C 4: 109,757,692 probably benign Het
Fam227b A T 2: 126,127,060 D31E probably benign Het
Fastkd2 A G 1: 63,737,836 D377G possibly damaging Het
Fbxl6 G A 15: 76,536,624 R384* probably null Het
Fcamr A T 1: 130,804,576 H44L probably damaging Het
Fhod3 A G 18: 25,090,761 N1055D probably benign Het
Garem1 A T 18: 21,148,806 Y164* probably null Het
Gemin4 C T 11: 76,212,888 C349Y probably damaging Het
Gnal A G 18: 67,135,370 probably null Het
Hacl1 T C 14: 31,634,191 probably benign Het
Hectd3 T C 4: 116,998,530 V409A probably benign Het
Hps6 A G 19: 46,004,053 E143G probably damaging Het
Hspa4 T A 11: 53,270,949 I459L probably benign Het
Ighv3-6 G A 12: 114,288,441 Q21* probably null Het
Ints3 G A 3: 90,403,987 R438* probably null Het
Jmjd6 T C 11: 116,841,165 N237D probably benign Het
Lrrk2 C A 15: 91,778,504 T1912K probably damaging Het
Mdga2 C A 12: 67,221,206 probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Myh6 T C 14: 54,963,055 D203G probably benign Het
Myo5b T C 18: 74,716,037 S1116P probably damaging Het
Nalcn T A 14: 123,369,945 D704V probably benign Het
Nes A T 3: 87,971,236 M12L probably benign Het
Olfr1052 T A 2: 86,298,016 S67T probably damaging Het
Olfr118 A G 17: 37,672,967 T315A probably benign Het
Olfr1328 T C 4: 118,934,683 D53G probably damaging Het
Olfr453 T A 6: 42,744,076 I13N probably damaging Het
Pcdha2 T C 18: 36,941,323 V669A probably benign Het
Pdhx T C 2: 103,022,219 N433S probably damaging Het
Pip5kl1 A G 2: 32,579,112 R261G probably damaging Het
Ppp1r3a A T 6: 14,719,074 S614T probably damaging Het
Ptpru T C 4: 131,774,304 N1207S probably damaging Het
Ranbp2 T C 10: 58,476,472 F1005L probably benign Het
Rims2 A G 15: 39,437,845 E324G probably damaging Het
Sema6d A T 2: 124,656,850 I227L probably benign Het
Smarcad1 T G 6: 65,114,336 L1014V probably damaging Het
Spag9 T C 11: 94,044,417 V18A possibly damaging Het
Spag9 T G 11: 94,044,479 S39A possibly damaging Het
Sun2 T C 15: 79,734,155 K268E probably benign Het
Tbpl2 C T 2: 24,087,139 R289Q probably benign Het
Tcea3 T A 4: 136,255,143 probably benign Het
Tmem185a C T X: 70,462,186 probably null Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Vmn1r212 A T 13: 22,883,188 V325E unknown Het
Vmn1r35 T A 6: 66,679,073 R204S probably damaging Het
Vmn2r57 A G 7: 41,428,130 M204T probably damaging Het
Wdfy3 A T 5: 101,944,239 Y411* probably null Het
Zfp335 G T 2: 164,910,700 D41E probably damaging Het
Other mutations in Plekhj1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Plekhj1 APN 10 80796602 unclassified probably null
IGL02523:Plekhj1 APN 10 80797849 splice site probably null
PIT4403001:Plekhj1 UTSW 10 80796459 missense unknown
R0016:Plekhj1 UTSW 10 80796416 missense possibly damaging 0.90
R0288:Plekhj1 UTSW 10 80796610 missense probably damaging 1.00
R1136:Plekhj1 UTSW 10 80797820 unclassified probably null
R2262:Plekhj1 UTSW 10 80796472 missense probably benign 0.01
R3938:Plekhj1 UTSW 10 80797775 missense probably damaging 0.99
R4938:Plekhj1 UTSW 10 80797775 missense probably damaging 1.00
R7231:Plekhj1 UTSW 10 80797658 missense probably damaging 0.96
R7546:Plekhj1 UTSW 10 80797914 missense possibly damaging 0.52
R7782:Plekhj1 UTSW 10 80798345 unclassified probably benign
RF018:Plekhj1 UTSW 10 80796637 missense not run
Predicted Primers PCR Primer
(F):5'- TGCTATACACCCCACGTTCG -3'
(R):5'- GAAGCTGGTGGTCAACTTCCTC -3'

Sequencing Primer
(F):5'- ACCTCTCTCAGTTGGGAACG -3'
(R):5'- GCTGGTGGTCAACTTCCTCTTTTAC -3'
Posted On2015-04-17