Mutagenetix > Incidental Mutation

Incidental Mutation 'R3937:Mdga2'

307240

Institutional Source

Beutler Lab

Gene Symbol

Mdga2

Ensembl Gene

ENSMUSG00000034912

Gene Name

MAM domain containing glycosylphosphatidylinositol anchor 2

Synonyms

Adp, 6720489L24Rik, Mamdc1, 9330209L04Rik, Mdga2

MMRRC Submission

040921-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3937 (G1)

Quality Score

185

Status

Validated

Chromosome

Chromosomal Location

66466060-67222549 bp(-) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

C to A at 67221206 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000152613 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037181] [ENSMUST00000222167] [ENSMUST00000223141]

AlphaFold

P60755

Predicted Effect

unknown
Transcript: ENSMUST00000037181
AA Change: R15L

SMART Domains

Protein: ENSMUSP00000046761
Gene: ENSMUSG00000034912
AA Change: R15L

Domain	Start	End	E-Value	Type
IGc2	122	186	1.38e-15	SMART
IG	213	307	1.79e0	SMART
IGc2	324	386	1.56e-14	SMART
IGc2	419	493	4.43e-5	SMART
low complexity region	495	507	N/A	INTRINSIC
IGc2	525	591	1.97e-11	SMART
IG_like	621	687	2.5e0	SMART
Blast:FN3	707	795	4e-40	BLAST
MAM	812	990	3.4e-49	SMART
transmembrane domain	999	1021	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000101379

SMART Domains

Protein: ENSMUSP00000098930
Gene: ENSMUSG00000034912

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
SCOP:d1cs6a1	40	72	2e-5	SMART
Blast:IG	47	72	9e-11	BLAST

Predicted Effect

unknown
Transcript: ENSMUST00000178814
AA Change: R5L

SMART Domains

Protein: ENSMUSP00000137608
Gene: ENSMUSG00000034912
AA Change: R5L

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
IGc2	53	117	1.38e-15	SMART
IG	144	238	1.79e0	SMART
IGc2	255	317	1.56e-14	SMART
IGc2	350	424	4.43e-5	SMART
low complexity region	426	438	N/A	INTRINSIC
IGc2	456	522	1.97e-11	SMART
IG_like	552	618	2.5e0	SMART
Blast:FN3	638	726	3e-40	BLAST
MAM	736	914	1.38e-49	SMART
transmembrane domain	923	945	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000179025

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000179577

Predicted Effect

probably benign
Transcript: ENSMUST00000222167

Predicted Effect

probably benign
Transcript: ENSMUST00000223141

Meta Mutation Damage Score

0.0600

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

100% (60/60)

MGI Phenotype

PHENOTYPE: Mice that paternally inherit an allele disrupted by transgene insertion exhibit varying degrees of abnormalities in the skull, paw, and tail. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2510039O18Rik	T	G	4: 147,942,053	S343R	possibly damaging	Het
Abca8b	G	T	11: 109,974,567	P355T	probably benign	Het
Abhd15	T	C	11: 77,515,938	V247A	probably benign	Het
Adamts1	C	T	16: 85,795,619	V634M	possibly damaging	Het
BC049715	T	C	6: 136,840,455	I231T	possibly damaging	Het
Chpf	A	T	1: 75,477,540	V198E	probably damaging	Het
Cp	C	T	3: 19,971,034	P386S	probably damaging	Het
Cth	A	G	3: 157,920,040	I107T	possibly damaging	Het
Ctrc	T	C	4: 141,840,321	D157G	probably damaging	Het
D630003M21Rik	A	G	2: 158,200,360	Y889H	probably damaging	Het
Elavl3	A	G	9: 22,018,744	V288A	probably damaging	Het
Esyt3	A	T	9: 99,336,192	I130K	probably benign	Het
F13a1	A	T	13: 36,916,901	V423D	probably damaging	Het
Faf1	T	C	4: 109,757,692		probably benign	Het
Fam227b	A	T	2: 126,127,060	D31E	probably benign	Het
Fastkd2	A	G	1: 63,737,836	D377G	possibly damaging	Het
Fbxl6	G	A	15: 76,536,624	R384*	probably null	Het
Fcamr	A	T	1: 130,804,576	H44L	probably damaging	Het
Fhod3	A	G	18: 25,090,761	N1055D	probably benign	Het
Garem1	A	T	18: 21,148,806	Y164*	probably null	Het
Gemin4	C	T	11: 76,212,888	C349Y	probably damaging	Het
Gnal	A	G	18: 67,135,370		probably null	Het
Hacl1	T	C	14: 31,634,191		probably benign	Het
Hectd3	T	C	4: 116,998,530	V409A	probably benign	Het
Hps6	A	G	19: 46,004,053	E143G	probably damaging	Het
Hspa4	T	A	11: 53,270,949	I459L	probably benign	Het
Ighv3-6	G	A	12: 114,288,441	Q21*	probably null	Het
Ints3	G	A	3: 90,403,987	R438*	probably null	Het
Jmjd6	T	C	11: 116,841,165	N237D	probably benign	Het
Lrrk2	C	A	15: 91,778,504	T1912K	probably damaging	Het
Mroh2a	A	G	1: 88,258,664	S64G	probably benign	Het
Myh6	T	C	14: 54,963,055	D203G	probably benign	Het
Myo5b	T	C	18: 74,716,037	S1116P	probably damaging	Het
Nalcn	T	A	14: 123,369,945	D704V	probably benign	Het
Nes	A	T	3: 87,971,236	M12L	probably benign	Het
Olfr1052	T	A	2: 86,298,016	S67T	probably damaging	Het
Olfr118	A	G	17: 37,672,967	T315A	probably benign	Het
Olfr1328	T	C	4: 118,934,683	D53G	probably damaging	Het
Olfr453	T	A	6: 42,744,076	I13N	probably damaging	Het
Pcdha2	T	C	18: 36,941,323	V669A	probably benign	Het
Pdhx	T	C	2: 103,022,219	N433S	probably damaging	Het
Pip5kl1	A	G	2: 32,579,112	R261G	probably damaging	Het
Plekhj1	A	G	10: 80,797,775	I76T	probably damaging	Het
Ppp1r3a	A	T	6: 14,719,074	S614T	probably damaging	Het
Ptpru	T	C	4: 131,774,304	N1207S	probably damaging	Het
Ranbp2	T	C	10: 58,476,472	F1005L	probably benign	Het
Rims2	A	G	15: 39,437,845	E324G	probably damaging	Het
Sema6d	A	T	2: 124,656,850	I227L	probably benign	Het
Smarcad1	T	G	6: 65,114,336	L1014V	probably damaging	Het
Spag9	T	C	11: 94,044,417	V18A	possibly damaging	Het
Spag9	T	G	11: 94,044,479	S39A	possibly damaging	Het
Sun2	T	C	15: 79,734,155	K268E	probably benign	Het
Tbpl2	C	T	2: 24,087,139	R289Q	probably benign	Het
Tcea3	T	A	4: 136,255,143		probably benign	Het
Tmem185a	C	T	X: 70,462,186		probably null	Het
Tnrc6c	C	T	11: 117,723,529	R838W	probably damaging	Het
Vmn1r212	A	T	13: 22,883,188	V325E	unknown	Het
Vmn1r35	T	A	6: 66,679,073	R204S	probably damaging	Het
Vmn2r57	A	G	7: 41,428,130	M204T	probably damaging	Het
Wdfy3	A	T	5: 101,944,239	Y411*	probably null	Het
Zfp335	G	T	2: 164,910,700	D41E	probably damaging	Het

Other mutations in Mdga2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01343:Mdga2	APN	12	66723109	missense	probably damaging	0.97
IGL01632:Mdga2	APN	12	66629898	splice site	probably benign
IGL01843:Mdga2	APN	12	66723131	critical splice acceptor site	probably null
IGL02230:Mdga2	APN	12	66655423	nonsense	probably null
IGL02348:Mdga2	APN	12	66550575	missense	probably damaging	1.00
IGL02473:Mdga2	APN	12	66550611	missense	possibly damaging	0.73
IGL02795:Mdga2	APN	12	66689432	missense	probably benign	0.00
IGL02901:Mdga2	APN	12	66797809	splice site	probably benign
IGL03373:Mdga2	APN	12	66716722	missense	probably damaging	0.99
PIT4362001:Mdga2	UTSW	12	66797768	missense	possibly damaging	0.83
PIT4377001:Mdga2	UTSW	12	66716695	missense	probably damaging	0.99
R0106:Mdga2	UTSW	12	66716706	missense	probably damaging	1.00
R0106:Mdga2	UTSW	12	66716706	missense	probably damaging	1.00
R0110:Mdga2	UTSW	12	66470926	missense	possibly damaging	0.66
R0218:Mdga2	UTSW	12	66655120	missense	probably damaging	1.00
R0450:Mdga2	UTSW	12	66470926	missense	possibly damaging	0.66
R0801:Mdga2	UTSW	12	66486733	missense	probably damaging	1.00
R0847:Mdga2	UTSW	12	66723080	missense	probably damaging	1.00
R1056:Mdga2	UTSW	12	66723120	missense	probably damaging	0.97
R1086:Mdga2	UTSW	12	66506102	splice site	probably benign
R1335:Mdga2	UTSW	12	66716742	splice site	probably null
R1382:Mdga2	UTSW	12	66470916	missense	possibly damaging	0.68
R1490:Mdga2	UTSW	12	66797756	missense	probably benign	0.01
R1521:Mdga2	UTSW	12	66568926	missense	probably benign	0.00
R1556:Mdga2	UTSW	12	66550593	missense	possibly damaging	0.92
R1676:Mdga2	UTSW	12	66568772	missense	probably damaging	1.00
R1676:Mdga2	UTSW	12	66568773	nonsense	probably null
R1698:Mdga2	UTSW	12	66689335	missense	probably damaging	0.97
R1954:Mdga2	UTSW	12	66486708	splice site	probably benign
R2069:Mdga2	UTSW	12	66568917	nonsense	probably null
R2077:Mdga2	UTSW	12	66655362	missense	probably damaging	1.00
R2118:Mdga2	UTSW	12	66868752	missense	probably damaging	1.00
R2146:Mdga2	UTSW	12	66868741	missense	probably damaging	1.00
R2158:Mdga2	UTSW	12	66689381	missense	possibly damaging	0.64
R2189:Mdga2	UTSW	12	66473196	splice site	probably null
R2293:Mdga2	UTSW	12	66568985	nonsense	probably null
R2886:Mdga2	UTSW	12	66506270	splice site	probably benign
R2960:Mdga2	UTSW	12	66629978	nonsense	probably null
R4437:Mdga2	UTSW	12	66473198	splice site	probably null
R4514:Mdga2	UTSW	12	66716722	missense	probably damaging	0.99
R4693:Mdga2	UTSW	12	66797633	missense	possibly damaging	0.81
R4719:Mdga2	UTSW	12	66471001	unclassified	probably benign
R4744:Mdga2	UTSW	12	66797727	missense	probably benign	0.01
R4756:Mdga2	UTSW	12	66797653	missense	probably damaging	1.00
R4781:Mdga2	UTSW	12	66797622	splice site	probably null
R5022:Mdga2	UTSW	12	66470760	missense	possibly damaging	0.83
R5108:Mdga2	UTSW	12	66486741	missense	probably benign	0.43
R5479:Mdga2	UTSW	12	66655176	missense	probably damaging	1.00
R5710:Mdga2	UTSW	12	66506782	missense	probably damaging	1.00
R5816:Mdga2	UTSW	12	66655182	missense	probably damaging	1.00
R5822:Mdga2	UTSW	12	66655335	missense	probably damaging	1.00
R5996:Mdga2	UTSW	12	66797763	missense	probably benign	0.00
R6038:Mdga2	UTSW	12	66630053	missense	probably damaging	1.00
R6038:Mdga2	UTSW	12	66630053	missense	probably damaging	1.00
R6297:Mdga2	UTSW	12	66506253	missense	probably damaging	1.00
R6484:Mdga2	UTSW	12	66630069	missense	possibly damaging	0.90
R6830:Mdga2	UTSW	12	66723001	missense	probably damaging	1.00
R6912:Mdga2	UTSW	12	66506115	missense	probably benign	0.01
R6971:Mdga2	UTSW	12	66550561	missense	probably damaging	1.00
R7053:Mdga2	UTSW	12	66689384	missense	probably benign	0.41
R7069:Mdga2	UTSW	12	66486752	missense	probably benign	0.31
R7381:Mdga2	UTSW	12	66568896	missense	probably benign	0.44
R7474:Mdga2	UTSW	12	66486761	nonsense	probably null
R7559:Mdga2	UTSW	12	66473229	missense	probably damaging	1.00
R7581:Mdga2	UTSW	12	66506255	missense	probably damaging	0.99
R7596:Mdga2	UTSW	12	66506123	missense	probably damaging	0.99
R7745:Mdga2	UTSW	12	66689350	missense	probably damaging	0.99
R7745:Mdga2	UTSW	12	66689351	missense	possibly damaging	0.63
R7852:Mdga2	UTSW	12	66470950	missense	possibly damaging	0.66
R8144:Mdga2	UTSW	12	66655263	missense	probably damaging	1.00
R8319:Mdga2	UTSW	12	67221029	missense	unknown
R8715:Mdga2	UTSW	12	66868752	missense	probably damaging	1.00
R8977:Mdga2	UTSW	12	66797635	missense	possibly damaging	0.88
R9138:Mdga2	UTSW	12	66568889	missense	possibly damaging	0.89
R9177:Mdga2	UTSW	12	66470707	missense	possibly damaging	0.66
R9223:Mdga2	UTSW	12	66568860	missense	possibly damaging	0.81
R9248:Mdga2	UTSW	12	66689452	missense	possibly damaging	0.87
R9264:Mdga2	UTSW	12	66513283	missense	probably damaging	1.00
R9381:Mdga2	UTSW	12	66550530	missense	possibly damaging	0.64
R9456:Mdga2	UTSW	12	66568758	missense	probably benign	0.44
R9633:Mdga2	UTSW	12	66689432	missense	probably benign	0.00
Z1176:Mdga2	UTSW	12	66689443	missense	probably damaging	1.00
Z1186:Mdga2	UTSW	12	66568953	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- AATCCATCTTCACGTGAACATG -3'
(R):5'- AGAACACTTGTCCTCACAGCTC -3'

Sequencing Primer
(F):5'- TTCACGTGAACATGAACATATCCAG -3'
(R):5'- TGCGATTTTCCCAGGCG -3'

Posted On

2015-04-17