Incidental Mutation 'R3937:F13a1'
ID307242
Institutional Source Beutler Lab
Gene Symbol F13a1
Ensembl Gene ENSMUSG00000039109
Gene Namecoagulation factor XIII, A1 subunit
SynonymsFactor XIIIA, 1200014I03Rik
MMRRC Submission 040921-MU
Accession Numbers

Genbank: NM_028784; MGI: 1921395

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3937 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location36867178-37050244 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36916901 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 423 (V423D)
Ref Sequence ENSEMBL: ENSMUSP00000128316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037491] [ENSMUST00000164727]
Predicted Effect probably damaging
Transcript: ENSMUST00000037491
AA Change: V423D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048667
Gene: ENSMUSG00000039109
AA Change: V423D

DomainStartEndE-ValueType
Pfam:Transglut_N 47 165 9e-34 PFAM
TGc 307 400 2.01e-45 SMART
Pfam:Transglut_C 519 623 2e-26 PFAM
Pfam:Transglut_C 631 728 1.3e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164727
AA Change: V423D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128316
Gene: ENSMUSG00000039109
AA Change: V423D

DomainStartEndE-ValueType
Pfam:Transglut_N 46 167 3e-38 PFAM
TGc 307 400 2.01e-45 SMART
Pfam:Transglut_C 519 623 2.2e-23 PFAM
Pfam:Transglut_C 631 728 1.1e-22 PFAM
Meta Mutation Damage Score 0.7511 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: This gene encodes subunit A of the coagulation factor XIII that catalyzes the final step of the blood coagulation pathway. The encoded protein associates with subunit B to form a heterotetrameric proenzyme that undergoes thrombin-mediated proteolysis to generate active factor XIIIa. The transglutaminase activity of factor XIIIa is required for the calcium-dependent crosslinking of fibrin, leading to the formation of a clot. Mice lacking the encoded protein display impaired reproduction and reduced survival due to bleeding episodes, hematothorax, hematoperitoneum and subcutaneous hemorrhage. Additionally, mice lacking the encoded protein exhibit impaired wound healing and inadequate healing of myocardial infarction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mutant mice exhibit bleeding symptoms, increased lethality, and impaired fertility. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T G 4: 147,942,053 S343R possibly damaging Het
Abca8b G T 11: 109,974,567 P355T probably benign Het
Abhd15 T C 11: 77,515,938 V247A probably benign Het
Adamts1 C T 16: 85,795,619 V634M possibly damaging Het
BC049715 T C 6: 136,840,455 I231T possibly damaging Het
Chpf A T 1: 75,477,540 V198E probably damaging Het
Cp C T 3: 19,971,034 P386S probably damaging Het
Cth A G 3: 157,920,040 I107T possibly damaging Het
Ctrc T C 4: 141,840,321 D157G probably damaging Het
D630003M21Rik A G 2: 158,200,360 Y889H probably damaging Het
Elavl3 A G 9: 22,018,744 V288A probably damaging Het
Esyt3 A T 9: 99,336,192 I130K probably benign Het
Faf1 T C 4: 109,757,692 probably benign Het
Fam227b A T 2: 126,127,060 D31E probably benign Het
Fastkd2 A G 1: 63,737,836 D377G possibly damaging Het
Fbxl6 G A 15: 76,536,624 R384* probably null Het
Fcamr A T 1: 130,804,576 H44L probably damaging Het
Fhod3 A G 18: 25,090,761 N1055D probably benign Het
Garem1 A T 18: 21,148,806 Y164* probably null Het
Gemin4 C T 11: 76,212,888 C349Y probably damaging Het
Gnal A G 18: 67,135,370 probably null Het
Hacl1 T C 14: 31,634,191 probably benign Het
Hectd3 T C 4: 116,998,530 V409A probably benign Het
Hps6 A G 19: 46,004,053 E143G probably damaging Het
Hspa4 T A 11: 53,270,949 I459L probably benign Het
Ighv3-6 G A 12: 114,288,441 Q21* probably null Het
Ints3 G A 3: 90,403,987 R438* probably null Het
Jmjd6 T C 11: 116,841,165 N237D probably benign Het
Lrrk2 C A 15: 91,778,504 T1912K probably damaging Het
Mdga2 C A 12: 67,221,206 probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Myh6 T C 14: 54,963,055 D203G probably benign Het
Myo5b T C 18: 74,716,037 S1116P probably damaging Het
Nalcn T A 14: 123,369,945 D704V probably benign Het
Nes A T 3: 87,971,236 M12L probably benign Het
Olfr1052 T A 2: 86,298,016 S67T probably damaging Het
Olfr118 A G 17: 37,672,967 T315A probably benign Het
Olfr1328 T C 4: 118,934,683 D53G probably damaging Het
Olfr453 T A 6: 42,744,076 I13N probably damaging Het
Pcdha2 T C 18: 36,941,323 V669A probably benign Het
Pdhx T C 2: 103,022,219 N433S probably damaging Het
Pip5kl1 A G 2: 32,579,112 R261G probably damaging Het
Plekhj1 A G 10: 80,797,775 I76T probably damaging Het
Ppp1r3a A T 6: 14,719,074 S614T probably damaging Het
Ptpru T C 4: 131,774,304 N1207S probably damaging Het
Ranbp2 T C 10: 58,476,472 F1005L probably benign Het
Rims2 A G 15: 39,437,845 E324G probably damaging Het
Sema6d A T 2: 124,656,850 I227L probably benign Het
Smarcad1 T G 6: 65,114,336 L1014V probably damaging Het
Spag9 T C 11: 94,044,417 V18A possibly damaging Het
Spag9 T G 11: 94,044,479 S39A possibly damaging Het
Sun2 T C 15: 79,734,155 K268E probably benign Het
Tbpl2 C T 2: 24,087,139 R289Q probably benign Het
Tcea3 T A 4: 136,255,143 probably benign Het
Tmem185a C T X: 70,462,186 probably null Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Vmn1r212 A T 13: 22,883,188 V325E unknown Het
Vmn1r35 T A 6: 66,679,073 R204S probably damaging Het
Vmn2r57 A G 7: 41,428,130 M204T probably damaging Het
Wdfy3 A T 5: 101,944,239 Y411* probably null Het
Zfp335 G T 2: 164,910,700 D41E probably damaging Het
Other mutations in F13a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:F13a1 APN 13 36988878 missense probably benign 0.11
IGL01444:F13a1 APN 13 36918577 missense probably null 1.00
IGL02188:F13a1 APN 13 36906061 splice site probably benign
IGL02591:F13a1 APN 13 36898057 missense probably damaging 1.00
IGL02660:F13a1 APN 13 36943894 missense possibly damaging 0.92
IGL03244:F13a1 APN 13 36988896 missense possibly damaging 0.82
IGL03401:F13a1 APN 13 36898080 missense probably benign 0.00
F6893:F13a1 UTSW 13 36972025 missense probably damaging 1.00
R0082:F13a1 UTSW 13 36988953 missense probably damaging 0.99
R0657:F13a1 UTSW 13 36968105 missense probably damaging 0.96
R1225:F13a1 UTSW 13 37025851 missense probably benign
R1430:F13a1 UTSW 13 36898131 missense probably damaging 1.00
R1608:F13a1 UTSW 13 36868811 missense probably damaging 1.00
R1883:F13a1 UTSW 13 36989007 missense probably benign 0.01
R2115:F13a1 UTSW 13 36988857 missense probably damaging 1.00
R2121:F13a1 UTSW 13 37025679 missense probably benign 0.01
R2122:F13a1 UTSW 13 37025679 missense probably benign 0.01
R2125:F13a1 UTSW 13 36892841 missense probably benign 0.15
R2392:F13a1 UTSW 13 36943997 missense possibly damaging 0.65
R3618:F13a1 UTSW 13 36943993 missense probably damaging 1.00
R3625:F13a1 UTSW 13 36898093 missense probably benign 0.31
R3772:F13a1 UTSW 13 36898134 missense probably benign
R3838:F13a1 UTSW 13 37047424 missense probably damaging 1.00
R3857:F13a1 UTSW 13 37025694 missense probably benign 0.32
R4934:F13a1 UTSW 13 36877762 missense probably benign 0.00
R4974:F13a1 UTSW 13 36916863 critical splice donor site probably null
R5033:F13a1 UTSW 13 36988856 missense probably damaging 1.00
R5194:F13a1 UTSW 13 36972063 missense probably damaging 1.00
R5740:F13a1 UTSW 13 36898204 missense probably benign 0.02
R5753:F13a1 UTSW 13 36898108 nonsense probably null
R6188:F13a1 UTSW 13 37025778 missense probably benign 0.12
R7048:F13a1 UTSW 13 36898143 missense probably benign 0.02
R7197:F13a1 UTSW 13 36916886 missense probably damaging 1.00
Z1088:F13a1 UTSW 13 36989012 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGAGGCTGGAAAGATGTCTG -3'
(R):5'- ACATCAGTCATCTGTCTCCTGTAG -3'

Sequencing Primer
(F):5'- CTGGTTGACAGGAAGCATACTC -3'
(R):5'- ATCTGTCTCCTGTAGCCAGTGAAAG -3'
Posted On2015-04-17