Incidental Mutation 'R3938:Mpp4'
ID307259
Institutional Source Beutler Lab
Gene Symbol Mpp4
Ensembl Gene ENSMUSG00000079550
Gene Namemembrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4)
SynonymsDLG6
MMRRC Submission 040825-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3938 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location59120935-59163389 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59124683 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 466 (V466A)
Ref Sequence ENSEMBL: ENSMUSP00000140352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066374] [ENSMUST00000078874] [ENSMUST00000087475] [ENSMUST00000094917] [ENSMUST00000114275] [ENSMUST00000186395] [ENSMUST00000186477] [ENSMUST00000186794] [ENSMUST00000190014] [ENSMUST00000191200]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066374
AA Change: V510A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000070711
Gene: ENSMUSG00000079550
AA Change: V510A

DomainStartEndE-ValueType
L27 27 82 4.02e-9 SMART
L27 86 139 2.49e-14 SMART
PDZ 161 234 3.57e-11 SMART
SH3 244 310 2.94e-5 SMART
low complexity region 397 406 N/A INTRINSIC
GuKc 425 618 1.21e-50 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000078874
AA Change: V510A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000077914
Gene: ENSMUSG00000079550
AA Change: V510A

DomainStartEndE-ValueType
L27 27 82 4.02e-9 SMART
L27 86 139 2.49e-14 SMART
PDZ 161 234 3.57e-11 SMART
SH3 244 310 2.94e-5 SMART
low complexity region 348 362 N/A INTRINSIC
low complexity region 397 406 N/A INTRINSIC
GuKc 425 618 1.21e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000087475
SMART Domains Protein: ENSMUSP00000084745
Gene: ENSMUSG00000038079

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Pfam:TMEM237 134 382 4.4e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094917
SMART Domains Protein: ENSMUSP00000092522
Gene: ENSMUSG00000038079

DomainStartEndE-ValueType
Pfam:TMEM237 148 391 3.4e-101 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000114275
AA Change: V529A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109914
Gene: ENSMUSG00000079550
AA Change: V529A

DomainStartEndE-ValueType
L27 46 101 4.02e-9 SMART
L27 105 158 2.49e-14 SMART
PDZ 180 253 3.57e-11 SMART
SH3 263 329 2.94e-5 SMART
low complexity region 367 381 N/A INTRINSIC
low complexity region 416 425 N/A INTRINSIC
GuKc 444 637 1.21e-50 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180570
Predicted Effect probably benign
Transcript: ENSMUST00000186395
Predicted Effect possibly damaging
Transcript: ENSMUST00000186477
AA Change: V466A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140352
Gene: ENSMUSG00000079550
AA Change: V466A

DomainStartEndE-ValueType
L27 27 82 1.3e-11 SMART
L27 86 139 8.6e-17 SMART
PDZ 161 234 1.8e-13 SMART
SH3 222 297 5.1e-4 SMART
low complexity region 353 362 N/A INTRINSIC
GuKc 381 574 5.8e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186794
SMART Domains Protein: ENSMUSP00000139823
Gene: ENSMUSG00000038079

DomainStartEndE-ValueType
Pfam:TMEM237 158 406 5.2e-95 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187825
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188494
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189096
Predicted Effect probably benign
Transcript: ENSMUST00000190014
SMART Domains Protein: ENSMUSP00000140134
Gene: ENSMUSG00000038079

DomainStartEndE-ValueType
Pfam:TMEM237 129 230 9e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000191200
AA Change: V504A

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140957
Gene: ENSMUSG00000079550
AA Change: V504A

DomainStartEndE-ValueType
L27 27 82 4.02e-9 SMART
L27 86 139 2.49e-14 SMART
PDZ 161 234 3.57e-11 SMART
SH3 244 310 2.94e-5 SMART
low complexity region 342 356 N/A INTRINSIC
low complexity region 391 400 N/A INTRINSIC
GuKc 419 612 1.21e-50 SMART
Meta Mutation Damage Score 0.6834 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane-associated guanylate kinase (MAGUK) protein family, with an N-terminal PDZ domain, a central src homology 3 region (SH3), and a C-terminal guanylate kinase-like (GUK) domain. The protein is localized to the outer limiting membrane in the retina, and is thought to function in photoreceptor polarity and the organization of specialized intercellular junctions. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for mutations display sporadic photorecptor displacement. Correct protein localization at the presynaptic photoreceptor membrane. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,154,294 P1561L probably damaging Het
Adamts1 C T 16: 85,795,619 V634M possibly damaging Het
Arid4b A T 13: 14,186,928 N659I probably benign Het
BC049715 T C 6: 136,840,455 I231T possibly damaging Het
Bmp4 T C 14: 46,384,079 Y336C probably damaging Het
Ccdc30 G A 4: 119,352,673 T293I probably benign Het
Chd5 A T 4: 152,377,055 T1275S probably benign Het
Chtf8 A T 8: 106,885,905 M134K probably benign Het
Col11a2 A T 17: 34,039,625 probably benign Het
Cyp8b1 A G 9: 121,915,618 V216A probably benign Het
Dnah8 C T 17: 30,854,937 T4527M probably damaging Het
Elavl3 A G 9: 22,018,744 V288A probably damaging Het
Erap1 T A 13: 74,668,028 L92Q probably damaging Het
Exoc3l G T 8: 105,293,405 P296H probably damaging Het
Gm5294 A T 5: 138,820,968 N78Y probably damaging Het
Hacl1 T C 14: 31,634,191 probably benign Het
Hrnr T A 3: 93,322,855 N133K probably benign Het
Itgax G T 7: 128,136,273 R504S possibly damaging Het
Itgb4 A G 11: 116,005,926 S1461G possibly damaging Het
Klkb1 G T 8: 45,282,801 T175K probably damaging Het
Lrrk2 C A 15: 91,778,504 T1912K probably damaging Het
Lrrk2 A T 15: 91,712,780 D525V possibly damaging Het
Mdga1 G T 17: 29,857,622 Q59K probably damaging Het
Myh6 T C 14: 54,963,055 D203G probably benign Het
Myo5b T C 18: 74,716,037 S1116P probably damaging Het
Nemp1 T C 10: 127,695,473 L311P probably damaging Het
Nup205 A G 6: 35,219,742 R1138G probably damaging Het
Nup54 A G 5: 92,417,529 M443T probably damaging Het
Peak1 T C 9: 56,260,365 E93G probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plekhj1 A G 10: 80,797,775 I76T probably damaging Het
Poll A G 19: 45,558,418 probably benign Het
Ppp1r3a A T 6: 14,719,074 S614T probably damaging Het
Pygm A T 19: 6,392,950 I556F probably benign Het
Ranbp2 T C 10: 58,476,472 F1005L probably benign Het
Rcor3 G T 1: 192,101,085 T361K possibly damaging Het
Robo4 A G 9: 37,402,017 probably benign Het
Rps15 T C 10: 80,293,839 V96A probably benign Het
Rrm2 T A 12: 24,709,432 N55K probably damaging Het
Shank2 T C 7: 144,128,375 Y382H probably benign Het
Slc25a10 G T 11: 120,491,993 E3* probably null Het
Slc7a8 T A 14: 54,735,841 E223V probably benign Het
Snx13 A G 12: 35,144,097 K880E probably benign Het
Spinkl T G 18: 44,168,149 M41L probably benign Het
Srp54a A C 12: 55,089,257 N19T probably benign Het
Sun2 T C 15: 79,734,155 K268E probably benign Het
Sytl1 G A 4: 133,255,624 Q359* probably null Het
Tlr6 A T 5: 64,953,595 F656L probably damaging Het
Tmem185a C T X: 70,462,186 probably null Het
Tmem45a2 C T 16: 57,039,035 D278N probably benign Het
Trav7-1 T C 14: 52,655,334 probably benign Het
Trpc2 T A 7: 102,093,574 M597K probably damaging Het
Ttc21a A G 9: 119,950,816 probably benign Het
Usp9y C T Y: 1,313,741 M2188I probably damaging Het
Utrn C A 10: 12,750,030 probably null Het
Vmn1r35 T A 6: 66,679,073 R204S probably damaging Het
Zfp955b T A 17: 33,305,416 Y59F probably damaging Het
Other mutations in Mpp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Mpp4 APN 1 59149519 critical splice donor site probably null
IGL01346:Mpp4 APN 1 59125560 missense probably damaging 1.00
IGL01680:Mpp4 APN 1 59130067 missense probably benign 0.21
IGL02123:Mpp4 APN 1 59161466 splice site probably null
IGL02299:Mpp4 APN 1 59158579 splice site probably benign
IGL02793:Mpp4 APN 1 59136834 splice site probably null
IGL02875:Mpp4 APN 1 59136834 splice site probably null
E0370:Mpp4 UTSW 1 59139758 splice site probably benign
R0391:Mpp4 UTSW 1 59143829 splice site probably benign
R0517:Mpp4 UTSW 1 59124727 nonsense probably null
R0725:Mpp4 UTSW 1 59121422 missense probably damaging 1.00
R0968:Mpp4 UTSW 1 59130090 missense probably damaging 1.00
R1753:Mpp4 UTSW 1 59144810 missense probably null 1.00
R1956:Mpp4 UTSW 1 59158652 missense probably benign 0.01
R1968:Mpp4 UTSW 1 59144802 missense probably damaging 1.00
R2062:Mpp4 UTSW 1 59143782 missense possibly damaging 0.92
R2064:Mpp4 UTSW 1 59143782 missense possibly damaging 0.92
R2065:Mpp4 UTSW 1 59143782 missense possibly damaging 0.92
R2068:Mpp4 UTSW 1 59143782 missense possibly damaging 0.92
R2088:Mpp4 UTSW 1 59123465 missense possibly damaging 0.68
R2108:Mpp4 UTSW 1 59143782 missense possibly damaging 0.92
R2426:Mpp4 UTSW 1 59130057 missense probably damaging 0.99
R2897:Mpp4 UTSW 1 59144694 missense probably benign
R2898:Mpp4 UTSW 1 59144694 missense probably benign
R3908:Mpp4 UTSW 1 59149037 missense probably damaging 0.99
R4050:Mpp4 UTSW 1 59146744 splice site probably null
R4396:Mpp4 UTSW 1 59144802 missense possibly damaging 0.56
R4908:Mpp4 UTSW 1 59125589 missense probably damaging 1.00
R5169:Mpp4 UTSW 1 59130097 critical splice acceptor site probably null
R5185:Mpp4 UTSW 1 59125583 missense probably benign 0.10
R5249:Mpp4 UTSW 1 59144858 splice site probably benign
R5333:Mpp4 UTSW 1 59157441 missense probably benign 0.03
R5563:Mpp4 UTSW 1 59124629 critical splice donor site probably null
R5779:Mpp4 UTSW 1 59151666 missense probably benign 0.09
R5829:Mpp4 UTSW 1 59128942 missense probably damaging 0.99
R5934:Mpp4 UTSW 1 59121376 missense probably damaging 1.00
R6017:Mpp4 UTSW 1 59121359 missense probably damaging 1.00
R6845:Mpp4 UTSW 1 59144804 missense probably benign 0.05
R7013:Mpp4 UTSW 1 59149615 missense probably damaging 1.00
R7292:Mpp4 UTSW 1 59143810 missense possibly damaging 0.51
R7775:Mpp4 UTSW 1 59123513 missense not run
R7778:Mpp4 UTSW 1 59123513 missense not run
R7912:Mpp4 UTSW 1 59121362 missense probably damaging 1.00
R7993:Mpp4 UTSW 1 59121362 missense probably damaging 1.00
X0013:Mpp4 UTSW 1 59123453 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- GCCCGGAGATATGAGAGTTAGTC -3'
(R):5'- AGGCCATCTCTCAGCTGTAG -3'

Sequencing Primer
(F):5'- CGGAGATATGAGAGTTAGTCTTACTC -3'
(R):5'- GAGGCCATCTCTCAGCTGAAAGTC -3'
Posted On2015-04-17