Incidental Mutation 'R3938:Chd5'
ID 307264
Institutional Source Beutler Lab
Gene Symbol Chd5
Ensembl Gene ENSMUSG00000005045
Gene Name chromodomain helicase DNA binding protein 5
Synonyms
MMRRC Submission 040825-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R3938 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 152338651-152390194 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 152377055 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 1275 (T1275S)
Ref Sequence ENSEMBL: ENSMUSP00000005175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005175] [ENSMUST00000030775] [ENSMUST00000164662]
AlphaFold A2A8L1
Predicted Effect probably benign
Transcript: ENSMUST00000005175
AA Change: T1275S

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000005175
Gene: ENSMUSG00000005045
AA Change: T1275S

DomainStartEndE-ValueType
low complexity region 17 40 N/A INTRINSIC
low complexity region 46 71 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
Pfam:CHDNT 149 203 2e-32 PFAM
low complexity region 209 220 N/A INTRINSIC
low complexity region 256 273 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
low complexity region 323 333 N/A INTRINSIC
PHD 347 390 1.09e-14 SMART
RING 348 389 4.48e-1 SMART
low complexity region 400 416 N/A INTRINSIC
PHD 420 463 3.29e-14 SMART
RING 421 462 4.15e0 SMART
CHROMO 468 548 2.52e-13 SMART
CHROMO 592 649 1.34e-8 SMART
low complexity region 657 678 N/A INTRINSIC
DEXDc 698 910 8.34e-33 SMART
low complexity region 1023 1038 N/A INTRINSIC
HELICc 1056 1140 4.02e-26 SMART
DUF1087 1297 1361 2.78e-33 SMART
DUF1086 1374 1533 5.11e-105 SMART
low complexity region 1552 1567 N/A INTRINSIC
low complexity region 1685 1701 N/A INTRINSIC
Pfam:CHDCT2 1729 1901 1.7e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030775
AA Change: T1275S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000030775
Gene: ENSMUSG00000005045
AA Change: T1275S

DomainStartEndE-ValueType
low complexity region 17 40 N/A INTRINSIC
low complexity region 46 71 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
Pfam:CHDNT 150 203 9e-28 PFAM
low complexity region 209 220 N/A INTRINSIC
low complexity region 256 273 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
low complexity region 323 333 N/A INTRINSIC
PHD 347 390 1.09e-14 SMART
RING 348 389 4.48e-1 SMART
low complexity region 400 416 N/A INTRINSIC
PHD 420 463 3.29e-14 SMART
RING 421 462 4.15e0 SMART
CHROMO 468 548 2.52e-13 SMART
CHROMO 592 649 1.34e-8 SMART
low complexity region 657 678 N/A INTRINSIC
DEXDc 698 910 8.34e-33 SMART
low complexity region 1023 1038 N/A INTRINSIC
HELICc 1056 1140 4.02e-26 SMART
DUF1087 1297 1361 2.78e-33 SMART
DUF1086 1374 1533 5.11e-105 SMART
low complexity region 1552 1567 N/A INTRINSIC
low complexity region 1685 1701 N/A INTRINSIC
Pfam:CHDCT2 1730 1901 2.8e-93 PFAM
low complexity region 1922 1936 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124423
Predicted Effect probably benign
Transcript: ENSMUST00000164662
AA Change: T1238S

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000132600
Gene: ENSMUSG00000005045
AA Change: T1238S

DomainStartEndE-ValueType
low complexity region 17 40 N/A INTRINSIC
low complexity region 46 71 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
Pfam:CHDNT 149 203 1.9e-32 PFAM
low complexity region 209 220 N/A INTRINSIC
low complexity region 256 273 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
low complexity region 323 333 N/A INTRINSIC
PHD 347 390 1.09e-14 SMART
RING 348 389 4.48e-1 SMART
low complexity region 400 416 N/A INTRINSIC
PHD 420 463 3.29e-14 SMART
RING 421 462 4.15e0 SMART
CHROMO 468 548 2.52e-13 SMART
CHROMO 592 649 1.34e-8 SMART
low complexity region 657 678 N/A INTRINSIC
DEXDc 698 910 8.34e-33 SMART
low complexity region 1023 1038 N/A INTRINSIC
HELICc 1056 1140 4.02e-26 SMART
DUF1087 1260 1324 2.78e-33 SMART
DUF1086 1337 1496 5.11e-105 SMART
low complexity region 1515 1530 N/A INTRINSIC
low complexity region 1648 1664 N/A INTRINSIC
Pfam:CHDCT2 1692 1864 1.7e-99 PFAM
low complexity region 1885 1899 N/A INTRINSIC
Meta Mutation Damage Score 0.0586 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the chromodomain helicase DNA-binding protein family. Members of this family are characterized by a chromodomain, a helicase ATP-binding domain and an additional functional domain. This gene encodes a neuron-specific protein that may function in chromatin remodeling and gene transcription. This gene is a potential tumor suppressor gene that may play a role in the development of neuroblastoma. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility with abnormal spermiogenesis and chromatin condensation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,154,294 P1561L probably damaging Het
Adamts1 C T 16: 85,795,619 V634M possibly damaging Het
Arid4b A T 13: 14,186,928 N659I probably benign Het
BC049715 T C 6: 136,840,455 I231T possibly damaging Het
Bmp4 T C 14: 46,384,079 Y336C probably damaging Het
Ccdc30 G A 4: 119,352,673 T293I probably benign Het
Chtf8 A T 8: 106,885,905 M134K probably benign Het
Col11a2 A T 17: 34,039,625 probably benign Het
Cyp8b1 A G 9: 121,915,618 V216A probably benign Het
Dnah8 C T 17: 30,854,937 T4527M probably damaging Het
Elavl3 A G 9: 22,018,744 V288A probably damaging Het
Erap1 T A 13: 74,668,028 L92Q probably damaging Het
Exoc3l G T 8: 105,293,405 P296H probably damaging Het
Gm5294 A T 5: 138,820,968 N78Y probably damaging Het
Hacl1 T C 14: 31,634,191 probably benign Het
Hrnr T A 3: 93,322,855 N133K probably benign Het
Itgax G T 7: 128,136,273 R504S possibly damaging Het
Itgb4 A G 11: 116,005,926 S1461G possibly damaging Het
Klkb1 G T 8: 45,282,801 T175K probably damaging Het
Lrrk2 A T 15: 91,712,780 D525V possibly damaging Het
Lrrk2 C A 15: 91,778,504 T1912K probably damaging Het
Mdga1 G T 17: 29,857,622 Q59K probably damaging Het
Mpp4 A G 1: 59,124,683 V466A possibly damaging Het
Myh6 T C 14: 54,963,055 D203G probably benign Het
Myo5b T C 18: 74,716,037 S1116P probably damaging Het
Nemp1 T C 10: 127,695,473 L311P probably damaging Het
Nup205 A G 6: 35,219,742 R1138G probably damaging Het
Nup54 A G 5: 92,417,529 M443T probably damaging Het
Peak1 T C 9: 56,260,365 E93G probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plekhj1 A G 10: 80,797,775 I76T probably damaging Het
Poll A G 19: 45,558,418 probably benign Het
Ppp1r3a A T 6: 14,719,074 S614T probably damaging Het
Pygm A T 19: 6,392,950 I556F probably benign Het
Ranbp2 T C 10: 58,476,472 F1005L probably benign Het
Rcor3 G T 1: 192,101,085 T361K possibly damaging Het
Robo4 A G 9: 37,402,017 probably benign Het
Rps15 T C 10: 80,293,839 V96A probably benign Het
Rrm2 T A 12: 24,709,432 N55K probably damaging Het
Shank2 T C 7: 144,128,375 Y382H probably benign Het
Slc25a10 G T 11: 120,491,993 E3* probably null Het
Slc7a8 T A 14: 54,735,841 E223V probably benign Het
Snx13 A G 12: 35,144,097 K880E probably benign Het
Spinkl T G 18: 44,168,149 M41L probably benign Het
Srp54a A C 12: 55,089,257 N19T probably benign Het
Sun2 T C 15: 79,734,155 K268E probably benign Het
Sytl1 G A 4: 133,255,624 Q359* probably null Het
Tlr6 A T 5: 64,953,595 F656L probably damaging Het
Tmem185a C T X: 70,462,186 probably null Het
Tmem45a2 C T 16: 57,039,035 D278N probably benign Het
Trav7-1 T C 14: 52,655,334 probably benign Het
Trpc2 T A 7: 102,093,574 M597K probably damaging Het
Ttc21a A G 9: 119,950,816 probably benign Het
Usp9y C T Y: 1,313,741 M2188I probably damaging Het
Utrn C A 10: 12,750,030 probably null Het
Vmn1r35 T A 6: 66,679,073 R204S probably damaging Het
Zfp955b T A 17: 33,305,416 Y59F probably damaging Het
Other mutations in Chd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00537:Chd5 APN 4 152360602 missense probably damaging 1.00
IGL00886:Chd5 APN 4 152359699 missense probably benign 0.00
IGL00963:Chd5 APN 4 152382938 missense probably damaging 1.00
IGL01399:Chd5 APN 4 152356687 missense probably damaging 1.00
IGL01571:Chd5 APN 4 152384115 splice site probably benign
IGL01606:Chd5 APN 4 152360975 missense probably damaging 0.99
IGL01636:Chd5 APN 4 152384653 nonsense probably null
IGL02009:Chd5 APN 4 152366213 missense probably damaging 1.00
IGL02417:Chd5 APN 4 152367294 missense probably damaging 0.97
IGL02504:Chd5 APN 4 152363322 missense probably damaging 0.99
IGL02508:Chd5 APN 4 152363024 missense probably damaging 1.00
IGL02597:Chd5 APN 4 152371712 missense probably damaging 1.00
IGL02608:Chd5 APN 4 152356107 missense possibly damaging 0.94
IGL02612:Chd5 APN 4 152360576 missense probably damaging 1.00
IGL02658:Chd5 APN 4 152360593 missense probably damaging 1.00
IGL02662:Chd5 APN 4 152372131 missense probably damaging 1.00
IGL02676:Chd5 APN 4 152356073 splice site probably benign
IGL02871:Chd5 APN 4 152376685 missense probably damaging 1.00
IGL02942:Chd5 APN 4 152385725 missense probably damaging 0.98
IGL02956:Chd5 APN 4 152379956 missense probably benign 0.00
IGL03286:Chd5 APN 4 152385495 missense probably benign 0.00
IGL03348:Chd5 APN 4 152376685 missense probably damaging 1.00
IGL03398:Chd5 APN 4 152377082 missense probably damaging 0.97
PIT1430001:Chd5 UTSW 4 152370637 missense probably damaging 1.00
PIT4151001:Chd5 UTSW 4 152378529 missense probably damaging 0.99
R0079:Chd5 UTSW 4 152385749 missense probably damaging 1.00
R0241:Chd5 UTSW 4 152366132 missense probably damaging 1.00
R0241:Chd5 UTSW 4 152366132 missense probably damaging 1.00
R0379:Chd5 UTSW 4 152383321 missense probably benign 0.00
R0388:Chd5 UTSW 4 152371644 missense probably damaging 1.00
R0675:Chd5 UTSW 4 152385950 missense probably benign 0.06
R0730:Chd5 UTSW 4 152347984 missense possibly damaging 0.72
R0799:Chd5 UTSW 4 152384159 missense probably damaging 1.00
R0800:Chd5 UTSW 4 152356157 missense probably damaging 1.00
R1276:Chd5 UTSW 4 152378734 missense probably damaging 1.00
R1752:Chd5 UTSW 4 152375133 missense probably damaging 1.00
R1753:Chd5 UTSW 4 152378815 missense probably damaging 1.00
R1843:Chd5 UTSW 4 152385806 missense probably damaging 1.00
R1850:Chd5 UTSW 4 152370533 missense probably damaging 1.00
R1851:Chd5 UTSW 4 152378270 missense probably damaging 0.97
R1859:Chd5 UTSW 4 152380523 missense probably benign 0.00
R1983:Chd5 UTSW 4 152384666 missense possibly damaging 0.89
R2404:Chd5 UTSW 4 152367334 missense probably damaging 1.00
R2897:Chd5 UTSW 4 152372115 missense probably damaging 1.00
R2898:Chd5 UTSW 4 152372115 missense probably damaging 1.00
R3893:Chd5 UTSW 4 152360656 missense probably damaging 1.00
R4707:Chd5 UTSW 4 152360582 missense probably damaging 1.00
R4754:Chd5 UTSW 4 152377746 missense probably damaging 0.99
R4911:Chd5 UTSW 4 152360672 missense probably damaging 1.00
R4924:Chd5 UTSW 4 152366429 missense possibly damaging 0.50
R4926:Chd5 UTSW 4 152383311 missense probably benign 0.00
R5256:Chd5 UTSW 4 152372097 missense probably benign 0.01
R5524:Chd5 UTSW 4 152376630 missense probably benign
R5552:Chd5 UTSW 4 152385815 missense possibly damaging 0.95
R5895:Chd5 UTSW 4 152379932 missense probably benign 0.13
R5945:Chd5 UTSW 4 152379951 missense probably benign
R6007:Chd5 UTSW 4 152379421 missense probably null 1.00
R6039:Chd5 UTSW 4 152353621 small deletion probably benign
R6039:Chd5 UTSW 4 152353621 small deletion probably benign
R6172:Chd5 UTSW 4 152379391 missense probably damaging 1.00
R6173:Chd5 UTSW 4 152379391 missense probably damaging 1.00
R6323:Chd5 UTSW 4 152367334 missense probably damaging 0.99
R6331:Chd5 UTSW 4 152382408 missense probably benign 0.02
R6495:Chd5 UTSW 4 152367372 missense probably damaging 1.00
R6528:Chd5 UTSW 4 152356676 missense probably damaging 1.00
R6849:Chd5 UTSW 4 152378538 missense probably damaging 1.00
R6854:Chd5 UTSW 4 152382938 missense probably damaging 1.00
R6859:Chd5 UTSW 4 152378207 missense probably damaging 1.00
R6999:Chd5 UTSW 4 152374434 missense probably damaging 1.00
R7034:Chd5 UTSW 4 152360941 missense possibly damaging 0.89
R7110:Chd5 UTSW 4 152385439 missense probably damaging 1.00
R7361:Chd5 UTSW 4 152363288 missense probably damaging 0.99
R7397:Chd5 UTSW 4 152368012 missense possibly damaging 0.82
R7440:Chd5 UTSW 4 152384651 missense probably benign 0.01
R7489:Chd5 UTSW 4 152373468 missense probably damaging 1.00
R7810:Chd5 UTSW 4 152358575 missense probably damaging 0.97
R8057:Chd5 UTSW 4 152366372 missense probably damaging 1.00
R8078:Chd5 UTSW 4 152360991 missense possibly damaging 0.90
R8092:Chd5 UTSW 4 152378804 missense probably damaging 0.99
R8170:Chd5 UTSW 4 152376583 missense probably benign 0.26
R8255:Chd5 UTSW 4 152379423 missense probably damaging 0.99
R8348:Chd5 UTSW 4 152360716 missense probably damaging 0.98
R8448:Chd5 UTSW 4 152360716 missense probably damaging 0.98
R8478:Chd5 UTSW 4 152356690 nonsense probably null
R8482:Chd5 UTSW 4 152356690 nonsense probably null
R8670:Chd5 UTSW 4 152385496 missense possibly damaging 0.81
R8733:Chd5 UTSW 4 152379466 missense probably damaging 1.00
R8743:Chd5 UTSW 4 152366405 missense probably benign 0.03
R8941:Chd5 UTSW 4 152378848 missense possibly damaging 0.82
R9103:Chd5 UTSW 4 152376987 missense possibly damaging 0.62
R9160:Chd5 UTSW 4 152385459 missense probably damaging 0.99
R9221:Chd5 UTSW 4 152371665 missense probably damaging 0.96
R9399:Chd5 UTSW 4 152384135 missense probably benign 0.06
R9429:Chd5 UTSW 4 152362907 missense probably damaging 0.99
Z1176:Chd5 UTSW 4 152378479 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAGGCCGTTCTTAGCAGCTG -3'
(R):5'- GGCTTTTCAGAACACAGGAGAG -3'

Sequencing Primer
(F):5'- GTTCTTAGCAGCTGGCCCC -3'
(R):5'- TTTCTAGAGCAGGCCAAGAC -3'
Posted On 2015-04-17