Incidental Mutation 'R3938:Nup54'
ID307266
Institutional Source Beutler Lab
Gene Symbol Nup54
Ensembl Gene ENSMUSG00000034826
Gene Namenucleoporin 54
Synonyms54kDa, 3110079L04Rik
MMRRC Submission 040825-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R3938 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location92415540-92435219 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 92417529 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 443 (M443T)
Ref Sequence ENSEMBL: ENSMUSP00000046540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038514] [ENSMUST00000113083] [ENSMUST00000117108] [ENSMUST00000118106] [ENSMUST00000119587] [ENSMUST00000120193] [ENSMUST00000120416] [ENSMUST00000121096] [ENSMUST00000152041]
Predicted Effect probably damaging
Transcript: ENSMUST00000038514
AA Change: M443T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000046540
Gene: ENSMUSG00000034826
AA Change: M443T

DomainStartEndE-ValueType
low complexity region 5 109 N/A INTRINSIC
Pfam:Nup54 303 441 4.8e-49 PFAM
PDB:3T98|C 445 494 2e-26 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000113083
SMART Domains Protein: ENSMUSP00000108706
Gene: ENSMUSG00000034842

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 251 4.4e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117108
SMART Domains Protein: ENSMUSP00000113041
Gene: ENSMUSG00000034842

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 251 1.9e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118106
SMART Domains Protein: ENSMUSP00000114083
Gene: ENSMUSG00000034842

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 251 9e-66 PFAM
low complexity region 298 309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119587
SMART Domains Protein: ENSMUSP00000112648
Gene: ENSMUSG00000034842

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 251 4e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120193
SMART Domains Protein: ENSMUSP00000113074
Gene: ENSMUSG00000034842

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 251 8.4e-66 PFAM
low complexity region 298 309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120416
SMART Domains Protein: ENSMUSP00000113493
Gene: ENSMUSG00000034842

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 251 3.1e-65 PFAM
low complexity region 298 309 N/A INTRINSIC
low complexity region 366 373 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121096
SMART Domains Protein: ENSMUSP00000113510
Gene: ENSMUSG00000034842

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 251 1.8e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123694
Predicted Effect probably benign
Transcript: ENSMUST00000126281
SMART Domains Protein: ENSMUSP00000116110
Gene: ENSMUSG00000034842

DomainStartEndE-ValueType
Pfam:ART 1 190 3e-53 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129222
Predicted Effect probably benign
Transcript: ENSMUST00000138003
Predicted Effect probably benign
Transcript: ENSMUST00000152041
Meta Mutation Damage Score 0.4769 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear envelope creates distinct nuclear and cytoplasmic compartments in eukaryotic cells. It consists of two concentric membranes perforated by nuclear pores, large protein complexes that form aqueous channels to regulate the flow of macromolecules between the nucleus and the cytoplasm. These complexes are composed of at least 100 different polypeptide subunits, many of which belong to the nucleoporin family. This gene encodes a member of the phe-gly (FG) repeat-containing nucleoporin subset. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,154,294 P1561L probably damaging Het
Adamts1 C T 16: 85,795,619 V634M possibly damaging Het
Arid4b A T 13: 14,186,928 N659I probably benign Het
BC049715 T C 6: 136,840,455 I231T possibly damaging Het
Bmp4 T C 14: 46,384,079 Y336C probably damaging Het
Ccdc30 G A 4: 119,352,673 T293I probably benign Het
Chd5 A T 4: 152,377,055 T1275S probably benign Het
Chtf8 A T 8: 106,885,905 M134K probably benign Het
Col11a2 A T 17: 34,039,625 probably benign Het
Cyp8b1 A G 9: 121,915,618 V216A probably benign Het
Dnah8 C T 17: 30,854,937 T4527M probably damaging Het
Elavl3 A G 9: 22,018,744 V288A probably damaging Het
Erap1 T A 13: 74,668,028 L92Q probably damaging Het
Exoc3l G T 8: 105,293,405 P296H probably damaging Het
Gm5294 A T 5: 138,820,968 N78Y probably damaging Het
Hacl1 T C 14: 31,634,191 probably benign Het
Hrnr T A 3: 93,322,855 N133K probably benign Het
Itgax G T 7: 128,136,273 R504S possibly damaging Het
Itgb4 A G 11: 116,005,926 S1461G possibly damaging Het
Klkb1 G T 8: 45,282,801 T175K probably damaging Het
Lrrk2 A T 15: 91,712,780 D525V possibly damaging Het
Lrrk2 C A 15: 91,778,504 T1912K probably damaging Het
Mdga1 G T 17: 29,857,622 Q59K probably damaging Het
Mpp4 A G 1: 59,124,683 V466A possibly damaging Het
Myh6 T C 14: 54,963,055 D203G probably benign Het
Myo5b T C 18: 74,716,037 S1116P probably damaging Het
Nemp1 T C 10: 127,695,473 L311P probably damaging Het
Nup205 A G 6: 35,219,742 R1138G probably damaging Het
Peak1 T C 9: 56,260,365 E93G probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plekhj1 A G 10: 80,797,775 I76T probably damaging Het
Poll A G 19: 45,558,418 probably benign Het
Ppp1r3a A T 6: 14,719,074 S614T probably damaging Het
Pygm A T 19: 6,392,950 I556F probably benign Het
Ranbp2 T C 10: 58,476,472 F1005L probably benign Het
Rcor3 G T 1: 192,101,085 T361K possibly damaging Het
Robo4 A G 9: 37,402,017 probably benign Het
Rps15 T C 10: 80,293,839 V96A probably benign Het
Rrm2 T A 12: 24,709,432 N55K probably damaging Het
Shank2 T C 7: 144,128,375 Y382H probably benign Het
Slc25a10 G T 11: 120,491,993 E3* probably null Het
Slc7a8 T A 14: 54,735,841 E223V probably benign Het
Snx13 A G 12: 35,144,097 K880E probably benign Het
Spinkl T G 18: 44,168,149 M41L probably benign Het
Srp54a A C 12: 55,089,257 N19T probably benign Het
Sun2 T C 15: 79,734,155 K268E probably benign Het
Sytl1 G A 4: 133,255,624 Q359* probably null Het
Tlr6 A T 5: 64,953,595 F656L probably damaging Het
Tmem185a C T X: 70,462,186 probably null Het
Tmem45a2 C T 16: 57,039,035 D278N probably benign Het
Trav7-1 T C 14: 52,655,334 probably benign Het
Trpc2 T A 7: 102,093,574 M597K probably damaging Het
Ttc21a A G 9: 119,950,816 probably benign Het
Usp9y C T Y: 1,313,741 M2188I probably damaging Het
Utrn C A 10: 12,750,030 probably null Het
Vmn1r35 T A 6: 66,679,073 R204S probably damaging Het
Zfp955b T A 17: 33,305,416 Y59F probably damaging Het
Other mutations in Nup54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Nup54 APN 5 92417485 missense probably benign 0.00
IGL01526:Nup54 APN 5 92417475 missense probably benign 0.12
IGL01924:Nup54 APN 5 92424435 missense probably benign 0.02
IGL02248:Nup54 APN 5 92428329 splice site probably null
IGL02253:Nup54 APN 5 92417451 critical splice donor site probably null
IGL02508:Nup54 APN 5 92417539 nonsense probably null
IGL02721:Nup54 APN 5 92417857 missense possibly damaging 0.96
IGL03150:Nup54 APN 5 92428164 missense probably damaging 1.00
R0189:Nup54 UTSW 5 92422564 missense probably damaging 1.00
R1401:Nup54 UTSW 5 92428221 missense probably damaging 1.00
R1862:Nup54 UTSW 5 92419567 missense possibly damaging 0.75
R4171:Nup54 UTSW 5 92417484 missense possibly damaging 0.64
R4574:Nup54 UTSW 5 92425782 missense probably benign 0.17
R5372:Nup54 UTSW 5 92417857 missense probably damaging 1.00
R6003:Nup54 UTSW 5 92422994 missense probably damaging 1.00
R6191:Nup54 UTSW 5 92424294 missense probably damaging 0.99
R6197:Nup54 UTSW 5 92430804 utr 3 prime probably benign
R7861:Nup54 UTSW 5 92431093 missense unknown
R7944:Nup54 UTSW 5 92431093 missense unknown
R8005:Nup54 UTSW 5 92428147 missense probably benign 0.00
R8016:Nup54 UTSW 5 92434317 missense unknown
Z1177:Nup54 UTSW 5 92434279 missense unknown
Predicted Primers PCR Primer
(F):5'- TCTCCATTCTCATGACCAGGAG -3'
(R):5'- TGGTTCAAGGTGGTCAGTACAG -3'

Sequencing Primer
(F):5'- CTCATGACCAGGAGAGTATTTCTGC -3'
(R):5'- GTGGTCAGTACAGTTGTCCCATC -3'
Posted On2015-04-17