Mutagenetix > Incidental Mutation

Incidental Mutation 'R3938:Itgax'

307277

Institutional Source

Beutler Lab

Gene Symbol

Itgax

Ensembl Gene

ENSMUSG00000030789

Gene Name

integrin alpha X

Synonyms

Cd11c, CD11C (p150) alpha polypeptide

MMRRC Submission

040825-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.080) question?

Stock #

R3938 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

128129547-128150657 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 128136273 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 504 (R504S)

Ref Sequence

ENSEMBL: ENSMUSP00000033053 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033053] [ENSMUST00000205460]

AlphaFold

Q9QXH4

Predicted Effect

possibly damaging
Transcript: ENSMUST00000033053
AA Change: R504S

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000033053
Gene: ENSMUSG00000030789
AA Change: R504S

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Int_alpha	33	83	1.28e1	SMART
VWA	150	331	8.36e-43	SMART
Int_alpha	402	451	3.67e-3	SMART
Int_alpha	455	512	1.29e-7	SMART
Int_alpha	518	574	5.72e-14	SMART
Int_alpha	581	635	1.55e-1	SMART
transmembrane domain	1115	1137	N/A	INTRINSIC
Pfam:Integrin_alpha	1138	1152	6.2e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205408

Predicted Effect

probably benign
Transcript: ENSMUST00000205460

Meta Mutation Damage Score

0.2745

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.1%

Validation Efficiency

98% (57/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the integrin alpha X chain protein. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein combines with the beta 2 chain (ITGB2) to form a leukocyte-specific integrin referred to as inactivated-C3b (iC3b) receptor 4 (CR4). The alpha X beta 2 complex seems to overlap the properties of the alpha M beta 2 integrin in the adherence of neutrophils and monocytes to stimulated endothelium cells, and in the phagocytosis of complement coated particles. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to bacterial infection, decreased susceptibility to experimental autoimmune encephalomyelitis (EAE), increased T cell proliferation, and an abnormal pattern of cytokine production during EAE. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530053A07Rik	C	T	7: 28,154,294	P1561L	probably damaging	Het
Adamts1	C	T	16: 85,795,619	V634M	possibly damaging	Het
Arid4b	A	T	13: 14,186,928	N659I	probably benign	Het
BC049715	T	C	6: 136,840,455	I231T	possibly damaging	Het
Bmp4	T	C	14: 46,384,079	Y336C	probably damaging	Het
Ccdc30	G	A	4: 119,352,673	T293I	probably benign	Het
Chd5	A	T	4: 152,377,055	T1275S	probably benign	Het
Chtf8	A	T	8: 106,885,905	M134K	probably benign	Het
Col11a2	A	T	17: 34,039,625		probably benign	Het
Cyp8b1	A	G	9: 121,915,618	V216A	probably benign	Het
Dnah8	C	T	17: 30,854,937	T4527M	probably damaging	Het
Elavl3	A	G	9: 22,018,744	V288A	probably damaging	Het
Erap1	T	A	13: 74,668,028	L92Q	probably damaging	Het
Exoc3l	G	T	8: 105,293,405	P296H	probably damaging	Het
Gm5294	A	T	5: 138,820,968	N78Y	probably damaging	Het
Hacl1	T	C	14: 31,634,191		probably benign	Het
Hrnr	T	A	3: 93,322,855	N133K	probably benign	Het
Itgb4	A	G	11: 116,005,926	S1461G	possibly damaging	Het
Klkb1	G	T	8: 45,282,801	T175K	probably damaging	Het
Lrrk2	A	T	15: 91,712,780	D525V	possibly damaging	Het
Lrrk2	C	A	15: 91,778,504	T1912K	probably damaging	Het
Mdga1	G	T	17: 29,857,622	Q59K	probably damaging	Het
Mpp4	A	G	1: 59,124,683	V466A	possibly damaging	Het
Myh6	T	C	14: 54,963,055	D203G	probably benign	Het
Myo5b	T	C	18: 74,716,037	S1116P	probably damaging	Het
Nemp1	T	C	10: 127,695,473	L311P	probably damaging	Het
Nup205	A	G	6: 35,219,742	R1138G	probably damaging	Het
Nup54	A	G	5: 92,417,529	M443T	probably damaging	Het
Peak1	T	C	9: 56,260,365	E93G	probably benign	Het
Pirb	A	T	7: 3,717,638	L287Q	probably benign	Het
Plekhj1	A	G	10: 80,797,775	I76T	probably damaging	Het
Poll	A	G	19: 45,558,418		probably benign	Het
Ppp1r3a	A	T	6: 14,719,074	S614T	probably damaging	Het
Pygm	A	T	19: 6,392,950	I556F	probably benign	Het
Ranbp2	T	C	10: 58,476,472	F1005L	probably benign	Het
Rcor3	G	T	1: 192,101,085	T361K	possibly damaging	Het
Robo4	A	G	9: 37,402,017		probably benign	Het
Rps15	T	C	10: 80,293,839	V96A	probably benign	Het
Rrm2	T	A	12: 24,709,432	N55K	probably damaging	Het
Shank2	T	C	7: 144,128,375	Y382H	probably benign	Het
Slc25a10	G	T	11: 120,491,993	E3*	probably null	Het
Slc7a8	T	A	14: 54,735,841	E223V	probably benign	Het
Snx13	A	G	12: 35,144,097	K880E	probably benign	Het
Spinkl	T	G	18: 44,168,149	M41L	probably benign	Het
Srp54a	A	C	12: 55,089,257	N19T	probably benign	Het
Sun2	T	C	15: 79,734,155	K268E	probably benign	Het
Sytl1	G	A	4: 133,255,624	Q359*	probably null	Het
Tlr6	A	T	5: 64,953,595	F656L	probably damaging	Het
Tmem185a	C	T	X: 70,462,186		probably null	Het
Tmem45a2	C	T	16: 57,039,035	D278N	probably benign	Het
Trav7-1	T	C	14: 52,655,334		probably benign	Het
Trpc2	T	A	7: 102,093,574	M597K	probably damaging	Het
Ttc21a	A	G	9: 119,950,816		probably benign	Het
Usp9y	C	T	Y: 1,313,741	M2188I	probably damaging	Het
Utrn	C	A	10: 12,750,030		probably null	Het
Vmn1r35	T	A	6: 66,679,073	R204S	probably damaging	Het
Zfp955b	T	A	17: 33,305,416	Y59F	probably damaging	Het

Other mutations in Itgax

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Itgax	APN	7	128135326	missense	probably damaging	1.00
IGL00325:Itgax	APN	7	128148309	missense	possibly damaging	0.69
IGL01155:Itgax	APN	7	128145035	missense	probably benign	0.00
IGL01461:Itgax	APN	7	128135018	missense	probably damaging	1.00
IGL01508:Itgax	APN	7	128144818	missense	probably damaging	1.00
IGL01549:Itgax	APN	7	128131206	splice site	probably null
IGL01864:Itgax	APN	7	128133763	missense	probably benign	0.00
IGL02094:Itgax	APN	7	128131473	missense	probably damaging	1.00
IGL02364:Itgax	APN	7	128139982	missense	possibly damaging	0.89
IGL02969:Itgax	APN	7	128149123	missense	probably benign
IGL03406:Itgax	APN	7	128149198	missense	possibly damaging	0.93
Adendritic	UTSW	7	128148572	nonsense	probably null
PIT4651001:Itgax	UTSW	7	128149110	missense	probably benign	0.11
R0366:Itgax	UTSW	7	128149089	splice site	probably benign
R0763:Itgax	UTSW	7	128147940	splice site	probably benign
R1072:Itgax	UTSW	7	128150144	missense	probably damaging	0.96
R1659:Itgax	UTSW	7	128130891	missense	probably benign	0.15
R2019:Itgax	UTSW	7	128148526	missense	probably benign
R2418:Itgax	UTSW	7	128142333	missense	probably damaging	0.98
R3027:Itgax	UTSW	7	128148572	nonsense	probably null
R3846:Itgax	UTSW	7	128133767	missense	probably damaging	1.00
R4021:Itgax	UTSW	7	128133139	critical splice donor site	probably null
R4027:Itgax	UTSW	7	128141266	missense	possibly damaging	0.75
R4163:Itgax	UTSW	7	128144700	missense	probably benign	0.00
R4923:Itgax	UTSW	7	128148528	missense	probably benign
R5259:Itgax	UTSW	7	128148278	missense	probably damaging	0.99
R5333:Itgax	UTSW	7	128142283	missense	probably damaging	1.00
R5347:Itgax	UTSW	7	128141302	missense	probably benign	0.08
R5679:Itgax	UTSW	7	128134990	missense	probably benign	0.00
R5725:Itgax	UTSW	7	128147861	missense	possibly damaging	0.63
R5733:Itgax	UTSW	7	128140475	missense	probably damaging	0.99
R5750:Itgax	UTSW	7	128144706	missense	probably benign	0.32
R5964:Itgax	UTSW	7	128140447	missense	probably damaging	1.00
R6004:Itgax	UTSW	7	128131452	missense	probably damaging	0.96
R6168:Itgax	UTSW	7	128133097	missense	probably damaging	0.99
R6212:Itgax	UTSW	7	128130332	missense	possibly damaging	0.52
R6212:Itgax	UTSW	7	128147853	missense	probably benign	0.16
R6480:Itgax	UTSW	7	128148599	missense	probably benign	0.12
R6484:Itgax	UTSW	7	128133718	missense	probably benign	0.13
R6796:Itgax	UTSW	7	128135064	missense	probably damaging	1.00
R6844:Itgax	UTSW	7	128147934	splice site	probably null
R7287:Itgax	UTSW	7	128148505	missense	probably damaging	1.00
R7365:Itgax	UTSW	7	128135309	missense	probably damaging	1.00
R7421:Itgax	UTSW	7	128140432	missense	probably damaging	1.00
R7599:Itgax	UTSW	7	128148090	missense	probably damaging	0.99
R7710:Itgax	UTSW	7	128135856	missense	probably benign	0.04
R7964:Itgax	UTSW	7	128140418	critical splice acceptor site	probably null
R8220:Itgax	UTSW	7	128130918	missense	probably benign	0.00
R8730:Itgax	UTSW	7	128139894	critical splice acceptor site	probably null
R8742:Itgax	UTSW	7	128144623	missense	probably benign	0.28
R8812:Itgax	UTSW	7	128133807	missense	probably damaging	1.00
R8871:Itgax	UTSW	7	128136051	missense	probably damaging	1.00
R9147:Itgax	UTSW	7	128148741	missense	possibly damaging	0.74
R9149:Itgax	UTSW	7	128131469	missense	probably benign	0.01
R9310:Itgax	UTSW	7	128142260	nonsense	probably null
R9376:Itgax	UTSW	7	128148763	missense	possibly damaging	0.94
R9377:Itgax	UTSW	7	128133677	missense	probably benign	0.03
R9641:Itgax	UTSW	7	128141980	missense	probably damaging	1.00
R9650:Itgax	UTSW	7	128135763	missense	probably benign	0.24
R9709:Itgax	UTSW	7	128136328	missense	probably damaging	1.00
X0061:Itgax	UTSW	7	128129607	start gained	probably benign
Z1176:Itgax	UTSW	7	128144872	missense	probably benign	0.24
Z1177:Itgax	UTSW	7	128148062	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- ACTGACCTGGTCCTGATTGG -3'
(R):5'- AGATAGTGACTGGGCCTTACCTG -3'

Sequencing Primer
(F):5'- GATTGGAGTCCCCCATTACTATGAG -3'
(R):5'- ATGTCCTGTCTTGAGGCTCCATG -3'

Posted On

2015-04-17