Mutagenetix > Incidental Mutation

Incidental Mutation 'R3938:Shank2'

307278

Institutional Source

Beutler Lab

Gene Symbol

Shank2

Ensembl Gene

ENSMUSG00000037541

Gene Name

SH3 and multiple ankyrin repeat domains 2

Synonyms

ProSAP1

MMRRC Submission

040825-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3938 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

144001928-144424494 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 144128375 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 382 (Y382H)

Ref Sequence

ENSEMBL: ENSMUSP00000101522 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105902] [ENSMUST00000213146]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000105902
AA Change: Y382H

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000101522
Gene: ENSMUSG00000037541
AA Change: Y382H

Domain	Start	End	E-Value	Type
low complexity region	15	28	N/A	INTRINSIC
Pfam:FERM_f0	57	140	1.4e-21	PFAM
ANK	196	226	1.4e1	SMART
ANK	230	259	2.77e-3	SMART
ANK	263	293	1.42e0	SMART
ANK	297	326	1.25e-1	SMART
ANK	330	359	7.83e-3	SMART
ANK	363	391	1.29e2	SMART
SH3	529	584	1.04e-14	SMART
PDZ	635	720	1.75e-14	SMART
low complexity region	724	743	N/A	INTRINSIC
low complexity region	878	893	N/A	INTRINSIC
low complexity region	1031	1043	N/A	INTRINSIC
low complexity region	1118	1129	N/A	INTRINSIC
low complexity region	1149	1161	N/A	INTRINSIC
low complexity region	1198	1216	N/A	INTRINSIC
low complexity region	1393	1407	N/A	INTRINSIC
low complexity region	1462	1473	N/A	INTRINSIC
low complexity region	1494	1516	N/A	INTRINSIC
low complexity region	1530	1546	N/A	INTRINSIC
low complexity region	1568	1576	N/A	INTRINSIC
low complexity region	1656	1670	N/A	INTRINSIC
low complexity region	1713	1728	N/A	INTRINSIC
low complexity region	1752	1766	N/A	INTRINSIC
SAM	1775	1841	2.52e-23	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000213146
AA Change: Y382H

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

Meta Mutation Damage Score

0.0771

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.1%

Validation Efficiency

98% (57/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the Shank family of synaptic proteins that may function as molecular scaffolds in the postsynaptic density of excitatory synapses. Shank proteins contain multiple domains for protein-protein interaction, including ankyrin repeats, and an SH3 domain. This particular family member contains a PDZ domain, a consensus sequence for cortactin SH3 domain-binding peptides and a sterile alpha motif. The alternative splicing demonstrated in Shank genes has been suggested as a mechanism for regulating the molecular structure of Shank and the spectrum of Shank-interacting proteins in the postsynaptic densities of the adult and developing brain. Alterations in the encoded protein may be associated with susceptibility to autism spectrum disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for null mutations display hyperactivity and abnormal social behavior. Mice homozygous for one null allele also display partial postnal lethality and limb grasping. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530053A07Rik	C	T	7: 28,154,294	P1561L	probably damaging	Het
Adamts1	C	T	16: 85,795,619	V634M	possibly damaging	Het
Arid4b	A	T	13: 14,186,928	N659I	probably benign	Het
BC049715	T	C	6: 136,840,455	I231T	possibly damaging	Het
Bmp4	T	C	14: 46,384,079	Y336C	probably damaging	Het
Ccdc30	G	A	4: 119,352,673	T293I	probably benign	Het
Chd5	A	T	4: 152,377,055	T1275S	probably benign	Het
Chtf8	A	T	8: 106,885,905	M134K	probably benign	Het
Col11a2	A	T	17: 34,039,625		probably benign	Het
Cyp8b1	A	G	9: 121,915,618	V216A	probably benign	Het
Dnah8	C	T	17: 30,854,937	T4527M	probably damaging	Het
Elavl3	A	G	9: 22,018,744	V288A	probably damaging	Het
Erap1	T	A	13: 74,668,028	L92Q	probably damaging	Het
Exoc3l	G	T	8: 105,293,405	P296H	probably damaging	Het
Gm5294	A	T	5: 138,820,968	N78Y	probably damaging	Het
Hacl1	T	C	14: 31,634,191		probably benign	Het
Hrnr	T	A	3: 93,322,855	N133K	probably benign	Het
Itgax	G	T	7: 128,136,273	R504S	possibly damaging	Het
Itgb4	A	G	11: 116,005,926	S1461G	possibly damaging	Het
Klkb1	G	T	8: 45,282,801	T175K	probably damaging	Het
Lrrk2	A	T	15: 91,712,780	D525V	possibly damaging	Het
Lrrk2	C	A	15: 91,778,504	T1912K	probably damaging	Het
Mdga1	G	T	17: 29,857,622	Q59K	probably damaging	Het
Mpp4	A	G	1: 59,124,683	V466A	possibly damaging	Het
Myh6	T	C	14: 54,963,055	D203G	probably benign	Het
Myo5b	T	C	18: 74,716,037	S1116P	probably damaging	Het
Nemp1	T	C	10: 127,695,473	L311P	probably damaging	Het
Nup205	A	G	6: 35,219,742	R1138G	probably damaging	Het
Nup54	A	G	5: 92,417,529	M443T	probably damaging	Het
Peak1	T	C	9: 56,260,365	E93G	probably benign	Het
Pirb	A	T	7: 3,717,638	L287Q	probably benign	Het
Plekhj1	A	G	10: 80,797,775	I76T	probably damaging	Het
Poll	A	G	19: 45,558,418		probably benign	Het
Ppp1r3a	A	T	6: 14,719,074	S614T	probably damaging	Het
Pygm	A	T	19: 6,392,950	I556F	probably benign	Het
Ranbp2	T	C	10: 58,476,472	F1005L	probably benign	Het
Rcor3	G	T	1: 192,101,085	T361K	possibly damaging	Het
Robo4	A	G	9: 37,402,017		probably benign	Het
Rps15	T	C	10: 80,293,839	V96A	probably benign	Het
Rrm2	T	A	12: 24,709,432	N55K	probably damaging	Het
Slc25a10	G	T	11: 120,491,993	E3*	probably null	Het
Slc7a8	T	A	14: 54,735,841	E223V	probably benign	Het
Snx13	A	G	12: 35,144,097	K880E	probably benign	Het
Spinkl	T	G	18: 44,168,149	M41L	probably benign	Het
Srp54a	A	C	12: 55,089,257	N19T	probably benign	Het
Sun2	T	C	15: 79,734,155	K268E	probably benign	Het
Sytl1	G	A	4: 133,255,624	Q359*	probably null	Het
Tlr6	A	T	5: 64,953,595	F656L	probably damaging	Het
Tmem185a	C	T	X: 70,462,186		probably null	Het
Tmem45a2	C	T	16: 57,039,035	D278N	probably benign	Het
Trav7-1	T	C	14: 52,655,334		probably benign	Het
Trpc2	T	A	7: 102,093,574	M597K	probably damaging	Het
Ttc21a	A	G	9: 119,950,816		probably benign	Het
Usp9y	C	T	Y: 1,313,741	M2188I	probably damaging	Het
Utrn	C	A	10: 12,750,030		probably null	Het
Vmn1r35	T	A	6: 66,679,073	R204S	probably damaging	Het
Zfp955b	T	A	17: 33,305,416	Y59F	probably damaging	Het

Other mutations in Shank2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Shank2	APN	7	144411847	missense	probably damaging	1.00
IGL00516:Shank2	APN	7	144410775	missense	possibly damaging	0.96
IGL00919:Shank2	APN	7	144411271	missense	probably damaging	0.97
IGL01450:Shank2	APN	7	144285068	nonsense	probably null
IGL01996:Shank2	APN	7	144411493	missense	probably damaging	1.00
IGL02217:Shank2	APN	7	144285047	missense	possibly damaging	0.59
IGL02314:Shank2	APN	7	144411271	missense	probably benign	0.01
IGL02320:Shank2	APN	7	144420944	missense	probably damaging	1.00
IGL02948:Shank2	APN	7	144409636	missense	probably benign	0.03
IGL02997:Shank2	APN	7	144081873	missense	probably benign	0.16
R0077:Shank2	UTSW	7	144192467	missense	possibly damaging	0.85
R0109:Shank2	UTSW	7	144410577	missense	possibly damaging	0.81
R0126:Shank2	UTSW	7	144031355	missense	probably damaging	0.99
R0153:Shank2	UTSW	7	144070135	missense	probably benign	0.04
R0644:Shank2	UTSW	7	144411849	missense	probably benign
R1072:Shank2	UTSW	7	144411568	missense	probably damaging	1.00
R1245:Shank2	UTSW	7	144411720	missense	probably benign	0.00
R1424:Shank2	UTSW	7	144052372	missense	probably damaging	0.99
R1712:Shank2	UTSW	7	144411153	missense	probably damaging	1.00
R1739:Shank2	UTSW	7	144179853	missense	probably damaging	1.00
R1791:Shank2	UTSW	7	144410599	missense	probably damaging	1.00
R1889:Shank2	UTSW	7	144186858	nonsense	probably null
R2074:Shank2	UTSW	7	144409540	missense	probably damaging	1.00
R2135:Shank2	UTSW	7	144411234	missense	probably damaging	0.99
R2355:Shank2	UTSW	7	144057718	missense	possibly damaging	0.94
R2511:Shank2	UTSW	7	144411577	missense	probably damaging	1.00
R2517:Shank2	UTSW	7	144052305	missense	possibly damaging	0.89
R2570:Shank2	UTSW	7	144068770	missense	probably damaging	1.00
R2846:Shank2	UTSW	7	144070055	missense	probably damaging	1.00
R3159:Shank2	UTSW	7	144081874	missense	probably damaging	0.98
R3881:Shank2	UTSW	7	144405384	missense	probably benign
R3907:Shank2	UTSW	7	144409576	missense	probably damaging	1.00
R4151:Shank2	UTSW	7	144054828	missense	probably damaging	1.00
R4369:Shank2	UTSW	7	144179781	missense	probably damaging	0.99
R4372:Shank2	UTSW	7	144410862	missense	probably benign	0.09
R4519:Shank2	UTSW	7	144410205	missense	probably damaging	1.00
R4627:Shank2	UTSW	7	144411424	missense	probably damaging	1.00
R4645:Shank2	UTSW	7	144410422	missense	possibly damaging	0.65
R4647:Shank2	UTSW	7	144411829	missense	probably damaging	1.00
R4689:Shank2	UTSW	7	144420605	missense	probably benign	0.07
R4751:Shank2	UTSW	7	144409468	missense	probably damaging	1.00
R4816:Shank2	UTSW	7	144052306	missense	probably damaging	1.00
R4843:Shank2	UTSW	7	144031409	missense	probably benign	0.17
R4929:Shank2	UTSW	7	144411271	missense	probably benign	0.01
R5009:Shank2	UTSW	7	144070179	missense	probably benign	0.00
R5027:Shank2	UTSW	7	144259105	nonsense	probably null
R5165:Shank2	UTSW	7	144409636	missense	possibly damaging	0.62
R5278:Shank2	UTSW	7	144068875	critical splice donor site	probably null
R5332:Shank2	UTSW	7	144411292	missense	possibly damaging	0.82
R5497:Shank2	UTSW	7	144409534	missense	probably damaging	1.00
R5525:Shank2	UTSW	7	144070109	missense	probably damaging	1.00
R5575:Shank2	UTSW	7	144410134	missense	probably damaging	1.00
R5948:Shank2	UTSW	7	144407223	missense	probably damaging	0.98
R6024:Shank2	UTSW	7	144180031	missense	probably benign	0.12
R6306:Shank2	UTSW	7	144409680	missense	probably benign	0.00
R6317:Shank2	UTSW	7	144285084	missense	possibly damaging	0.89
R6358:Shank2	UTSW	7	144031297	missense	probably benign	0.25
R6364:Shank2	UTSW	7	144410409	missense	probably benign	0.14
R6413:Shank2	UTSW	7	144410218	missense	probably damaging	1.00
R6680:Shank2	UTSW	7	144420866	missense	probably damaging	1.00
R6834:Shank2	UTSW	7	144409894	missense	probably damaging	1.00
R6870:Shank2	UTSW	7	144052460	missense	probably damaging	0.99
R6933:Shank2	UTSW	7	144091778	missense	probably benign	0.19
R6983:Shank2	UTSW	7	144081848	missense	possibly damaging	0.94
R7082:Shank2	UTSW	7	144410359	missense	probably damaging	0.99
R7100:Shank2	UTSW	7	144411164	missense	possibly damaging	0.73
R7111:Shank2	UTSW	7	144411552	missense	probably benign	0.00
R7213:Shank2	UTSW	7	144031409	missense	probably benign	0.17
R7225:Shank2	UTSW	7	144285025	missense	probably benign	0.42
R7325:Shank2	UTSW	7	144411685	missense	probably benign	0.04
R7605:Shank2	UTSW	7	144091779	missense	possibly damaging	0.64
R7909:Shank2	UTSW	7	144411394	missense	probably damaging	1.00
R7976:Shank2	UTSW	7	144411061	missense	probably damaging	0.99
R8118:Shank2	UTSW	7	144409875	missense	probably benign	0.01
R8722:Shank2	UTSW	7	144175748	intron	probably benign
R8866:Shank2	UTSW	7	144411249	missense	probably benign
R8919:Shank2	UTSW	7	144411528	missense	probably damaging	1.00
R8944:Shank2	UTSW	7	144070190	missense	probably damaging	1.00
R9033:Shank2	UTSW	7	144411499	missense	probably damaging	0.99
R9091:Shank2	UTSW	7	144409968	missense	possibly damaging	0.76
R9252:Shank2	UTSW	7	144068798	missense	possibly damaging	0.96
R9270:Shank2	UTSW	7	144409968	missense	possibly damaging	0.76
R9350:Shank2	UTSW	7	144407208	missense	probably benign	0.00
R9362:Shank2	UTSW	7	144409534	missense	probably damaging	1.00
R9471:Shank2	UTSW	7	144411015	missense	possibly damaging	0.77
R9524:Shank2	UTSW	7	144410446	missense	possibly damaging	0.71
R9557:Shank2	UTSW	7	144410110	missense	probably benign	0.00
R9559:Shank2	UTSW	7	144031304	missense	probably benign	0.30
R9574:Shank2	UTSW	7	144068725	missense	possibly damaging	0.90
R9680:Shank2	UTSW	7	144411100	missense	probably damaging	0.96
R9720:Shank2	UTSW	7	144128400	missense	probably damaging	0.99
RF009:Shank2	UTSW	7	144411571	missense	possibly damaging	0.81
Z1176:Shank2	UTSW	7	144128377	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGTGGTCATTTTCTTGAGACCC -3'
(R):5'- CACTTCACATGTGCCTGTAGC -3'

Sequencing Primer
(F):5'- ACTCTAACCTGGAGTTGTAAGGC -3'
(R):5'- TCAGGAGAGAGGAGAGTGGTACTC -3'

Posted On

2015-04-17