Incidental Mutation 'R3938:Exoc3l'
ID307280
Institutional Source Beutler Lab
Gene Symbol Exoc3l
Ensembl Gene ENSMUSG00000043251
Gene Nameexocyst complex component 3-like
SynonymsC730015A04Rik
MMRRC Submission 040825-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.212) question?
Stock #R3938 (G1)
Quality Score147
Status Validated
Chromosome8
Chromosomal Location105289924-105296101 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 105293405 bp
ZygosityHeterozygous
Amino Acid Change Proline to Histidine at position 296 (P296H)
Ref Sequence ENSEMBL: ENSMUSP00000053766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014981] [ENSMUST00000015003] [ENSMUST00000057855] [ENSMUST00000171788] [ENSMUST00000212219] [ENSMUST00000212922] [ENSMUST00000212777]
Predicted Effect probably benign
Transcript: ENSMUST00000014981
SMART Domains Protein: ENSMUSP00000014981
Gene: ENSMUSG00000014837

DomainStartEndE-ValueType
DUF1704 148 457 1.07e-139 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000015003
SMART Domains Protein: ENSMUSP00000015003
Gene: ENSMUSG00000014859

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
E2F_TDP 17 83 3.56e-31 SMART
Pfam:E2F_CC-MB 100 196 2.8e-36 PFAM
low complexity region 201 252 N/A INTRINSIC
low complexity region 360 372 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000057855
AA Change: P296H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053766
Gene: ENSMUSG00000043251
AA Change: P296H

DomainStartEndE-ValueType
Pfam:Sec6 189 722 5.4e-116 PFAM
low complexity region 723 739 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171788
SMART Domains Protein: ENSMUSP00000128530
Gene: ENSMUSG00000014837

DomainStartEndE-ValueType
DUF1704 148 457 1.07e-139 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212138
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212215
Predicted Effect probably benign
Transcript: ENSMUST00000212219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212232
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212261
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212974
Predicted Effect probably benign
Transcript: ENSMUST00000212922
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212359
Predicted Effect probably benign
Transcript: ENSMUST00000212777
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212529
Meta Mutation Damage Score 0.5867 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,154,294 P1561L probably damaging Het
Adamts1 C T 16: 85,795,619 V634M possibly damaging Het
Arid4b A T 13: 14,186,928 N659I probably benign Het
BC049715 T C 6: 136,840,455 I231T possibly damaging Het
Bmp4 T C 14: 46,384,079 Y336C probably damaging Het
Ccdc30 G A 4: 119,352,673 T293I probably benign Het
Chd5 A T 4: 152,377,055 T1275S probably benign Het
Chtf8 A T 8: 106,885,905 M134K probably benign Het
Col11a2 A T 17: 34,039,625 probably benign Het
Cyp8b1 A G 9: 121,915,618 V216A probably benign Het
Dnah8 C T 17: 30,854,937 T4527M probably damaging Het
Elavl3 A G 9: 22,018,744 V288A probably damaging Het
Erap1 T A 13: 74,668,028 L92Q probably damaging Het
Gm5294 A T 5: 138,820,968 N78Y probably damaging Het
Hacl1 T C 14: 31,634,191 probably benign Het
Hrnr T A 3: 93,322,855 N133K probably benign Het
Itgax G T 7: 128,136,273 R504S possibly damaging Het
Itgb4 A G 11: 116,005,926 S1461G possibly damaging Het
Klkb1 G T 8: 45,282,801 T175K probably damaging Het
Lrrk2 C A 15: 91,778,504 T1912K probably damaging Het
Lrrk2 A T 15: 91,712,780 D525V possibly damaging Het
Mdga1 G T 17: 29,857,622 Q59K probably damaging Het
Mpp4 A G 1: 59,124,683 V466A possibly damaging Het
Myh6 T C 14: 54,963,055 D203G probably benign Het
Myo5b T C 18: 74,716,037 S1116P probably damaging Het
Nemp1 T C 10: 127,695,473 L311P probably damaging Het
Nup205 A G 6: 35,219,742 R1138G probably damaging Het
Nup54 A G 5: 92,417,529 M443T probably damaging Het
Peak1 T C 9: 56,260,365 E93G probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plekhj1 A G 10: 80,797,775 I76T probably damaging Het
Poll A G 19: 45,558,418 probably benign Het
Ppp1r3a A T 6: 14,719,074 S614T probably damaging Het
Pygm A T 19: 6,392,950 I556F probably benign Het
Ranbp2 T C 10: 58,476,472 F1005L probably benign Het
Rcor3 G T 1: 192,101,085 T361K possibly damaging Het
Robo4 A G 9: 37,402,017 probably benign Het
Rps15 T C 10: 80,293,839 V96A probably benign Het
Rrm2 T A 12: 24,709,432 N55K probably damaging Het
Shank2 T C 7: 144,128,375 Y382H probably benign Het
Slc25a10 G T 11: 120,491,993 E3* probably null Het
Slc7a8 T A 14: 54,735,841 E223V probably benign Het
Snx13 A G 12: 35,144,097 K880E probably benign Het
Spinkl T G 18: 44,168,149 M41L probably benign Het
Srp54a A C 12: 55,089,257 N19T probably benign Het
Sun2 T C 15: 79,734,155 K268E probably benign Het
Sytl1 G A 4: 133,255,624 Q359* probably null Het
Tlr6 A T 5: 64,953,595 F656L probably damaging Het
Tmem185a C T X: 70,462,186 probably null Het
Tmem45a2 C T 16: 57,039,035 D278N probably benign Het
Trav7-1 T C 14: 52,655,334 probably benign Het
Trpc2 T A 7: 102,093,574 M597K probably damaging Het
Ttc21a A G 9: 119,950,816 probably benign Het
Usp9y C T Y: 1,313,741 M2188I probably damaging Het
Utrn C A 10: 12,750,030 probably null Het
Vmn1r35 T A 6: 66,679,073 R204S probably damaging Het
Zfp955b T A 17: 33,305,416 Y59F probably damaging Het
Other mutations in Exoc3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Exoc3l APN 8 105290498 missense probably benign 0.25
IGL01731:Exoc3l APN 8 105292955 missense probably benign 0.16
IGL02364:Exoc3l APN 8 105290577 missense possibly damaging 0.71
IGL02413:Exoc3l APN 8 105292438 missense probably damaging 1.00
IGL02512:Exoc3l APN 8 105290483 missense probably damaging 1.00
IGL02810:Exoc3l APN 8 105295348 missense probably damaging 1.00
R0045:Exoc3l UTSW 8 105293685 missense probably damaging 1.00
R0045:Exoc3l UTSW 8 105293685 missense probably damaging 1.00
R0183:Exoc3l UTSW 8 105295300 missense probably damaging 1.00
R0302:Exoc3l UTSW 8 105293543 missense probably benign 0.01
R1660:Exoc3l UTSW 8 105293060 critical splice donor site probably null
R1699:Exoc3l UTSW 8 105295013 missense probably benign 0.34
R1826:Exoc3l UTSW 8 105293618 missense probably damaging 0.97
R2275:Exoc3l UTSW 8 105290447 critical splice donor site probably null
R3928:Exoc3l UTSW 8 105290917 unclassified probably benign
R4261:Exoc3l UTSW 8 105290967 missense probably damaging 0.98
R4273:Exoc3l UTSW 8 105289961 makesense probably null
R5518:Exoc3l UTSW 8 105293163 missense probably benign 0.27
R6471:Exoc3l UTSW 8 105290534 missense probably damaging 1.00
R6511:Exoc3l UTSW 8 105293255 missense probably benign 0.00
R6631:Exoc3l UTSW 8 105295361 missense probably damaging 1.00
R6694:Exoc3l UTSW 8 105290490 missense probably benign 0.15
R6843:Exoc3l UTSW 8 105290097 missense probably benign 0.00
R7310:Exoc3l UTSW 8 105293708 missense probably damaging 1.00
R7387:Exoc3l UTSW 8 105294973 missense probably damaging 1.00
R7442:Exoc3l UTSW 8 105292926 missense probably damaging 1.00
R7764:Exoc3l UTSW 8 105290701 missense possibly damaging 0.62
R7845:Exoc3l UTSW 8 105290150 missense probably damaging 1.00
Z1176:Exoc3l UTSW 8 105290794 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- CACACTGAGCCTCTAATCGTC -3'
(R):5'- TGGAGACTGAGCGCACAATC -3'

Sequencing Primer
(F):5'- GAGCCTCTAATCGTCCCACTTC -3'
(R):5'- ACTGAGCGCACAATCCTGGG -3'
Posted On2015-04-17