Incidental Mutation 'R3938:Chtf8'
ID 307281
Institutional Source Beutler Lab
Gene Symbol Chtf8
Ensembl Gene ENSMUSG00000046691
Gene Name CTF8, chromosome transmission fidelity factor 8
Synonyms
MMRRC Submission 040825-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.341) question?
Stock # R3938 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 106883863-106893601 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 106885905 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 134 (M134K)
Ref Sequence ENSEMBL: ENSMUSP00000129823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034385] [ENSMUST00000169312] [ENSMUST00000175940] [ENSMUST00000175987] [ENSMUST00000176090] [ENSMUST00000176144] [ENSMUST00000176437] [ENSMUST00000176515] [ENSMUST00000177068]
AlphaFold P0CG15
Predicted Effect probably benign
Transcript: ENSMUST00000034385
SMART Domains Protein: ENSMUSP00000034385
Gene: ENSMUSG00000031910

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
transmembrane domain 42 64 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 85 361 4e-22 PFAM
Pfam:Glycos_transf_2 183 300 4.5e-7 PFAM
Pfam:Glyco_transf_21 188 360 5.7e-8 PFAM
Pfam:Chitin_synth_2 198 451 7.7e-17 PFAM
Pfam:Glyco_trans_2_3 211 538 1.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169312
AA Change: M134K

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000129823
Gene: ENSMUSG00000046691
AA Change: M134K

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
internal_repeat_1 37 246 5.18e-7 PROSPERO
low complexity region 258 269 N/A INTRINSIC
low complexity region 322 339 N/A INTRINSIC
internal_repeat_1 344 520 5.18e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000175940
SMART Domains Protein: ENSMUSP00000135077
Gene: ENSMUSG00000046691

DomainStartEndE-ValueType
Pfam:Ctf8 3 113 4.3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175987
SMART Domains Protein: ENSMUSP00000135596
Gene: ENSMUSG00000031910

DomainStartEndE-ValueType
transmembrane domain 11 33 N/A INTRINSIC
transmembrane domain 43 65 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 85 251 1.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176090
SMART Domains Protein: ENSMUSP00000135221
Gene: ENSMUSG00000046691

DomainStartEndE-ValueType
Pfam:Ctf8 1 94 8e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176144
SMART Domains Protein: ENSMUSP00000135303
Gene: ENSMUSG00000031910

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
transmembrane domain 42 64 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 85 361 4.5e-24 PFAM
Pfam:Glyco_transf_21 189 360 7e-8 PFAM
Pfam:Chitin_synth_2 197 457 3.2e-16 PFAM
Pfam:Glyco_trans_2_3 211 537 5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176437
SMART Domains Protein: ENSMUSP00000134860
Gene: ENSMUSG00000046691

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
low complexity region 109 120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176515
SMART Domains Protein: ENSMUSP00000135688
Gene: ENSMUSG00000046691

DomainStartEndE-ValueType
Pfam:Ctf8 1 94 8e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177068
SMART Domains Protein: ENSMUSP00000135029
Gene: ENSMUSG00000046691

DomainStartEndE-ValueType
Pfam:Ctf8 3 113 4.3e-26 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a short protein that forms part of the Ctf18 replication factor C (RFC) complex that occurs in both yeast and mammals. The heteroheptameric RFC complex plays a role in sister chromatid cohesion and may load the replication clamp PCNA (proliferating cell nuclear antigen) onto DNA during DNA replication and repair. This gene is ubiquitously expressed and has been shown to have reduced expression in renal and prostate tumors. Alternatively spliced transcript variants have been described. This gene has a pseudogene on chromosome X. [provided by RefSeq, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,154,294 P1561L probably damaging Het
Adamts1 C T 16: 85,795,619 V634M possibly damaging Het
Arid4b A T 13: 14,186,928 N659I probably benign Het
BC049715 T C 6: 136,840,455 I231T possibly damaging Het
Bmp4 T C 14: 46,384,079 Y336C probably damaging Het
Ccdc30 G A 4: 119,352,673 T293I probably benign Het
Chd5 A T 4: 152,377,055 T1275S probably benign Het
Col11a2 A T 17: 34,039,625 probably benign Het
Cyp8b1 A G 9: 121,915,618 V216A probably benign Het
Dnah8 C T 17: 30,854,937 T4527M probably damaging Het
Elavl3 A G 9: 22,018,744 V288A probably damaging Het
Erap1 T A 13: 74,668,028 L92Q probably damaging Het
Exoc3l G T 8: 105,293,405 P296H probably damaging Het
Gm5294 A T 5: 138,820,968 N78Y probably damaging Het
Hacl1 T C 14: 31,634,191 probably benign Het
Hrnr T A 3: 93,322,855 N133K probably benign Het
Itgax G T 7: 128,136,273 R504S possibly damaging Het
Itgb4 A G 11: 116,005,926 S1461G possibly damaging Het
Klkb1 G T 8: 45,282,801 T175K probably damaging Het
Lrrk2 A T 15: 91,712,780 D525V possibly damaging Het
Lrrk2 C A 15: 91,778,504 T1912K probably damaging Het
Mdga1 G T 17: 29,857,622 Q59K probably damaging Het
Mpp4 A G 1: 59,124,683 V466A possibly damaging Het
Myh6 T C 14: 54,963,055 D203G probably benign Het
Myo5b T C 18: 74,716,037 S1116P probably damaging Het
Nemp1 T C 10: 127,695,473 L311P probably damaging Het
Nup205 A G 6: 35,219,742 R1138G probably damaging Het
Nup54 A G 5: 92,417,529 M443T probably damaging Het
Peak1 T C 9: 56,260,365 E93G probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plekhj1 A G 10: 80,797,775 I76T probably damaging Het
Poll A G 19: 45,558,418 probably benign Het
Ppp1r3a A T 6: 14,719,074 S614T probably damaging Het
Pygm A T 19: 6,392,950 I556F probably benign Het
Ranbp2 T C 10: 58,476,472 F1005L probably benign Het
Rcor3 G T 1: 192,101,085 T361K possibly damaging Het
Robo4 A G 9: 37,402,017 probably benign Het
Rps15 T C 10: 80,293,839 V96A probably benign Het
Rrm2 T A 12: 24,709,432 N55K probably damaging Het
Shank2 T C 7: 144,128,375 Y382H probably benign Het
Slc25a10 G T 11: 120,491,993 E3* probably null Het
Slc7a8 T A 14: 54,735,841 E223V probably benign Het
Snx13 A G 12: 35,144,097 K880E probably benign Het
Spinkl T G 18: 44,168,149 M41L probably benign Het
Srp54a A C 12: 55,089,257 N19T probably benign Het
Sun2 T C 15: 79,734,155 K268E probably benign Het
Sytl1 G A 4: 133,255,624 Q359* probably null Het
Tlr6 A T 5: 64,953,595 F656L probably damaging Het
Tmem185a C T X: 70,462,186 probably null Het
Tmem45a2 C T 16: 57,039,035 D278N probably benign Het
Trav7-1 T C 14: 52,655,334 probably benign Het
Trpc2 T A 7: 102,093,574 M597K probably damaging Het
Ttc21a A G 9: 119,950,816 probably benign Het
Usp9y C T Y: 1,313,741 M2188I probably damaging Het
Utrn C A 10: 12,750,030 probably null Het
Vmn1r35 T A 6: 66,679,073 R204S probably damaging Het
Zfp955b T A 17: 33,305,416 Y59F probably damaging Het
Other mutations in Chtf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03344:Chtf8 APN 8 106886272 missense probably damaging 1.00
R0751:Chtf8 UTSW 8 106886477 splice site probably null
R0927:Chtf8 UTSW 8 106885518 missense probably damaging 0.99
R2087:Chtf8 UTSW 8 106885936 nonsense probably null
R2359:Chtf8 UTSW 8 106885416 splice site probably null
R4902:Chtf8 UTSW 8 106885792 missense probably damaging 1.00
R7105:Chtf8 UTSW 8 106885251 missense probably damaging 0.96
R8092:Chtf8 UTSW 8 106886306 missense possibly damaging 0.87
R8512:Chtf8 UTSW 8 106885434 missense probably benign
R8704:Chtf8 UTSW 8 106886040 missense probably benign 0.13
R8987:Chtf8 UTSW 8 106886103 missense probably benign
R9114:Chtf8 UTSW 8 106885849 missense probably benign
R9127:Chtf8 UTSW 8 106887008 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGCTTGATCTCAGATTTGGACTTGG -3'
(R):5'- GTCAAACCCAGCACACTTTG -3'

Sequencing Primer
(F):5'- CAACTGGCCTAGGATTGGG -3'
(R):5'- ACACTTTGCTGCTGGTGC -3'
Posted On 2015-04-17