Mutagenetix > Incidental Mutations

Incidental Mutation 'R3938:Peak1'

307283

Institutional Source

Beutler Lab

Gene Symbol

Peak1

Ensembl Gene

ENSMUSG00000074305

Gene Name

pseudopodium-enriched atypical kinase 1

Synonyms

C230081A13Rik, NKF3 kinase family member, 1110049L02Rik

MMRRC Submission

040825-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.189) question?

Stock #

R3938 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

56201126-56418067 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 56260365 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 93 (E93G)

Ref Sequence

ENSEMBL: ENSMUSP00000109901 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061552] [ENSMUST00000186735]

AlphaFold

Q69Z38

Predicted Effect

probably benign
Transcript: ENSMUST00000061552
AA Change: E93G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000109901
Gene: ENSMUSG00000074305
AA Change: E93G

Domain	Start	End	E-Value	Type
low complexity region	247	259	N/A	INTRINSIC
low complexity region	325	336	N/A	INTRINSIC
low complexity region	367	378	N/A	INTRINSIC
low complexity region	498	509	N/A	INTRINSIC
low complexity region	845	856	N/A	INTRINSIC
low complexity region	860	878	N/A	INTRINSIC
low complexity region	932	948	N/A	INTRINSIC
Pfam:Pkinase_Tyr	1437	1649	1.5e-6	PFAM
Pfam:Pkinase	1440	1651	2.3e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181444

Predicted Effect

probably benign
Transcript: ENSMUST00000186735

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192330

Meta Mutation Damage Score

0.0614

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.1%

Validation Efficiency

98% (57/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a non-receptor tyrosine kinase that is a member of the new kinase family three (NFK3) family. In migrating cells, the encoded protein is associated with the actin cytoskeleton and focal adhesions and promotes developing focal adhesion elongation. This protein may play a role in the regulation of cell migration, proliferation and cancer metastasis. [provided by RefSeq, Mar 2014]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530053A07Rik	C	T	7: 28,154,294	P1561L	probably damaging	Het
Adamts1	C	T	16: 85,795,619	V634M	possibly damaging	Het
Arid4b	A	T	13: 14,186,928	N659I	probably benign	Het
BC049715	T	C	6: 136,840,455	I231T	possibly damaging	Het
Bmp4	T	C	14: 46,384,079	Y336C	probably damaging	Het
Ccdc30	G	A	4: 119,352,673	T293I	probably benign	Het
Chd5	A	T	4: 152,377,055	T1275S	probably benign	Het
Chtf8	A	T	8: 106,885,905	M134K	probably benign	Het
Col11a2	A	T	17: 34,039,625		probably benign	Het
Cyp8b1	A	G	9: 121,915,618	V216A	probably benign	Het
Dnah8	C	T	17: 30,854,937	T4527M	probably damaging	Het
Elavl3	A	G	9: 22,018,744	V288A	probably damaging	Het
Erap1	T	A	13: 74,668,028	L92Q	probably damaging	Het
Exoc3l	G	T	8: 105,293,405	P296H	probably damaging	Het
Gm5294	A	T	5: 138,820,968	N78Y	probably damaging	Het
Hacl1	T	C	14: 31,634,191		probably benign	Het
Hrnr	T	A	3: 93,322,855	N133K	probably benign	Het
Itgax	G	T	7: 128,136,273	R504S	possibly damaging	Het
Itgb4	A	G	11: 116,005,926	S1461G	possibly damaging	Het
Klkb1	G	T	8: 45,282,801	T175K	probably damaging	Het
Lrrk2	A	T	15: 91,712,780	D525V	possibly damaging	Het
Lrrk2	C	A	15: 91,778,504	T1912K	probably damaging	Het
Mdga1	G	T	17: 29,857,622	Q59K	probably damaging	Het
Mpp4	A	G	1: 59,124,683	V466A	possibly damaging	Het
Myh6	T	C	14: 54,963,055	D203G	probably benign	Het
Myo5b	T	C	18: 74,716,037	S1116P	probably damaging	Het
Nemp1	T	C	10: 127,695,473	L311P	probably damaging	Het
Nup205	A	G	6: 35,219,742	R1138G	probably damaging	Het
Nup54	A	G	5: 92,417,529	M443T	probably damaging	Het
Pirb	A	T	7: 3,717,638	L287Q	probably benign	Het
Plekhj1	A	G	10: 80,797,775	I76T	probably damaging	Het
Poll	A	G	19: 45,558,418		probably benign	Het
Ppp1r3a	A	T	6: 14,719,074	S614T	probably damaging	Het
Pygm	A	T	19: 6,392,950	I556F	probably benign	Het
Ranbp2	T	C	10: 58,476,472	F1005L	probably benign	Het
Rcor3	G	T	1: 192,101,085	T361K	possibly damaging	Het
Robo4	A	G	9: 37,402,017		probably benign	Het
Rps15	T	C	10: 80,293,839	V96A	probably benign	Het
Rrm2	T	A	12: 24,709,432	N55K	probably damaging	Het
Shank2	T	C	7: 144,128,375	Y382H	probably benign	Het
Slc25a10	G	T	11: 120,491,993	E3*	probably null	Het
Slc7a8	T	A	14: 54,735,841	E223V	probably benign	Het
Snx13	A	G	12: 35,144,097	K880E	probably benign	Het
Spinkl	T	G	18: 44,168,149	M41L	probably benign	Het
Srp54a	A	C	12: 55,089,257	N19T	probably benign	Het
Sun2	T	C	15: 79,734,155	K268E	probably benign	Het
Sytl1	G	A	4: 133,255,624	Q359*	probably null	Het
Tlr6	A	T	5: 64,953,595	F656L	probably damaging	Het
Tmem185a	C	T	X: 70,462,186		probably null	Het
Tmem45a2	C	T	16: 57,039,035	D278N	probably benign	Het
Trav7-1	T	C	14: 52,655,334		probably benign	Het
Trpc2	T	A	7: 102,093,574	M597K	probably damaging	Het
Ttc21a	A	G	9: 119,950,816		probably benign	Het
Usp9y	C	T	Y: 1,313,741	M2188I	probably damaging	Het
Utrn	C	A	10: 12,750,030		probably null	Het
Vmn1r35	T	A	6: 66,679,073	R204S	probably damaging	Het
Zfp955b	T	A	17: 33,305,416	Y59F	probably damaging	Het

Other mutations in Peak1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00501:Peak1	APN	9	56227326	missense	probably damaging	1.00
IGL00544:Peak1	APN	9	56259978	missense	probably damaging	1.00
IGL01141:Peak1	APN	9	56258527	missense	probably benign	0.01
IGL01743:Peak1	APN	9	56259202	missense	probably damaging	1.00
IGL01781:Peak1	APN	9	56260065	missense	possibly damaging	0.92
IGL01885:Peak1	APN	9	56260104	missense	probably damaging	1.00
IGL01941:Peak1	APN	9	56258775	missense	probably damaging	1.00
IGL02455:Peak1	APN	9	56227473	missense	possibly damaging	0.89
IGL02719:Peak1	APN	9	56227206	missense	probably damaging	1.00
IGL03247:Peak1	APN	9	56257930	missense	probably damaging	1.00
IGL03259:Peak1	APN	9	56259967	missense	probably damaging	1.00
R0060:Peak1	UTSW	9	56227823	missense	probably damaging	1.00
R0087:Peak1	UTSW	9	56258325	missense	probably damaging	1.00
R0480:Peak1	UTSW	9	56258632	missense	probably benign	0.00
R0569:Peak1	UTSW	9	56260089	missense	probably damaging	1.00
R0605:Peak1	UTSW	9	56227098	splice site	probably benign
R0865:Peak1	UTSW	9	56257832	missense	probably benign	0.02
R1117:Peak1	UTSW	9	56258418	missense	probably benign	0.05
R1922:Peak1	UTSW	9	56206687	missense	probably damaging	1.00
R1959:Peak1	UTSW	9	56206789	missense	probably damaging	1.00
R2069:Peak1	UTSW	9	56258759	missense	probably damaging	1.00
R2083:Peak1	UTSW	9	56258949	missense	probably damaging	1.00
R2154:Peak1	UTSW	9	56207212	missense	probably damaging	1.00
R2407:Peak1	UTSW	9	56259226	missense	probably damaging	1.00
R3832:Peak1	UTSW	9	56258383	missense	probably benign
R3964:Peak1	UTSW	9	56259979	missense	probably damaging	1.00
R4192:Peak1	UTSW	9	56258741	missense	probably damaging	1.00
R4381:Peak1	UTSW	9	56258427	missense	probably benign	0.34
R4869:Peak1	UTSW	9	56227592	missense	probably benign	0.06
R4994:Peak1	UTSW	9	56241276	missense	possibly damaging	0.65
R5062:Peak1	UTSW	9	56260289	missense	probably damaging	1.00
R5435:Peak1	UTSW	9	56206486	missense	probably damaging	0.98
R5632:Peak1	UTSW	9	56257774	missense	probably damaging	1.00
R5643:Peak1	UTSW	9	56258755	missense	probably damaging	0.99
R5880:Peak1	UTSW	9	56207610	missense	probably damaging	1.00
R5898:Peak1	UTSW	9	56207338	missense	probably benign	0.19
R5986:Peak1	UTSW	9	56259442	missense	probably benign	0.00
R6109:Peak1	UTSW	9	56259283	missense	probably benign	0.01
R6284:Peak1	UTSW	9	56260296	missense	probably benign	0.10
R6347:Peak1	UTSW	9	56258211	missense	probably benign	0.00
R6374:Peak1	UTSW	9	56257666	missense	probably damaging	1.00
R6471:Peak1	UTSW	9	56258259	missense	probably damaging	1.00
R6717:Peak1	UTSW	9	56207239	missense	probably benign	0.00
R7033:Peak1	UTSW	9	56259707	missense	probably damaging	1.00
R7039:Peak1	UTSW	9	56257809	missense	probably benign	0.01
R7100:Peak1	UTSW	9	56259393	missense	probably damaging	1.00
R7604:Peak1	UTSW	9	56241207	nonsense	probably null
R7868:Peak1	UTSW	9	56260470	missense	probably damaging	1.00
R7979:Peak1	UTSW	9	56207392	missense	possibly damaging	0.52
R8258:Peak1	UTSW	9	56259393	missense	probably damaging	1.00
R8259:Peak1	UTSW	9	56259393	missense	probably damaging	1.00
R8272:Peak1	UTSW	9	56258898	missense	probably damaging	1.00
R8324:Peak1	UTSW	9	56207476	missense	probably damaging	1.00
R8516:Peak1	UTSW	9	56260000	missense	probably damaging	1.00
R8847:Peak1	UTSW	9	56207143	missense	probably damaging	1.00
R8895:Peak1	UTSW	9	56206654	missense	probably benign
R9082:Peak1	UTSW	9	56258220	missense	probably benign	0.07
R9138:Peak1	UTSW	9	56257641	missense	probably benign	0.34
R9355:Peak1	UTSW	9	56260170	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGCCCGCTATCTCCTTTAG -3'
(R):5'- AAAAGCTTGCACCAGCTTCC -3'

Sequencing Primer
(F):5'- AGCACTTCAGTTAGCCCGTTG -3'
(R):5'- GCTTCCTCCAGACTCTGAGAAG -3'

Posted On

2015-04-17