Incidental Mutation 'R3938:Cyp8b1'
ID 307285
Institutional Source Beutler Lab
Gene Symbol Cyp8b1
Ensembl Gene ENSMUSG00000050445
Gene Name cytochrome P450, family 8, subfamily b, polypeptide 1
Synonyms sterol 12-alpha-hydrolase
MMRRC Submission 040825-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.327) question?
Stock # R3938 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 121914356-121916305 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 121915618 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 216 (V216A)
Ref Sequence ENSEMBL: ENSMUSP00000052989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050327] [ENSMUST00000062474] [ENSMUST00000214340]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000050327
SMART Domains Protein: ENSMUSP00000050119
Gene: ENSMUSG00000044534

DomainStartEndE-ValueType
low complexity region 18 29 N/A INTRINSIC
Pfam:7tm_1 62 311 1e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000062474
AA Change: V216A

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000052989
Gene: ENSMUSG00000050445
AA Change: V216A

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
Pfam:p450 32 492 5.7e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214340
Meta Mutation Damage Score 0.1537 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum membrane protein catalyzes the conversion of 7 alpha-hydroxy-4-cholesten-3-one into 7-alpha,12-alpha-dihydroxy-4-cholesten-3-one. The balance between these two steroids determines the relative amounts of cholic acid and chenodeoxycholic acid both of which are secreted in the bile and affect the solubility of cholesterol. This gene is unique among the cytochrome P450 genes in that it is intronless. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele lack synthsesis of cholate (a primary bile acid) and its metabolites and display an increased bile acid pool and alterations in cholesterol metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,154,294 P1561L probably damaging Het
Adamts1 C T 16: 85,795,619 V634M possibly damaging Het
Arid4b A T 13: 14,186,928 N659I probably benign Het
BC049715 T C 6: 136,840,455 I231T possibly damaging Het
Bmp4 T C 14: 46,384,079 Y336C probably damaging Het
Ccdc30 G A 4: 119,352,673 T293I probably benign Het
Chd5 A T 4: 152,377,055 T1275S probably benign Het
Chtf8 A T 8: 106,885,905 M134K probably benign Het
Col11a2 A T 17: 34,039,625 probably benign Het
Dnah8 C T 17: 30,854,937 T4527M probably damaging Het
Elavl3 A G 9: 22,018,744 V288A probably damaging Het
Erap1 T A 13: 74,668,028 L92Q probably damaging Het
Exoc3l G T 8: 105,293,405 P296H probably damaging Het
Gm5294 A T 5: 138,820,968 N78Y probably damaging Het
Hacl1 T C 14: 31,634,191 probably benign Het
Hrnr T A 3: 93,322,855 N133K probably benign Het
Itgax G T 7: 128,136,273 R504S possibly damaging Het
Itgb4 A G 11: 116,005,926 S1461G possibly damaging Het
Klkb1 G T 8: 45,282,801 T175K probably damaging Het
Lrrk2 A T 15: 91,712,780 D525V possibly damaging Het
Lrrk2 C A 15: 91,778,504 T1912K probably damaging Het
Mdga1 G T 17: 29,857,622 Q59K probably damaging Het
Mpp4 A G 1: 59,124,683 V466A possibly damaging Het
Myh6 T C 14: 54,963,055 D203G probably benign Het
Myo5b T C 18: 74,716,037 S1116P probably damaging Het
Nemp1 T C 10: 127,695,473 L311P probably damaging Het
Nup205 A G 6: 35,219,742 R1138G probably damaging Het
Nup54 A G 5: 92,417,529 M443T probably damaging Het
Peak1 T C 9: 56,260,365 E93G probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plekhj1 A G 10: 80,797,775 I76T probably damaging Het
Poll A G 19: 45,558,418 probably benign Het
Ppp1r3a A T 6: 14,719,074 S614T probably damaging Het
Pygm A T 19: 6,392,950 I556F probably benign Het
Ranbp2 T C 10: 58,476,472 F1005L probably benign Het
Rcor3 G T 1: 192,101,085 T361K possibly damaging Het
Robo4 A G 9: 37,402,017 probably benign Het
Rps15 T C 10: 80,293,839 V96A probably benign Het
Rrm2 T A 12: 24,709,432 N55K probably damaging Het
Shank2 T C 7: 144,128,375 Y382H probably benign Het
Slc25a10 G T 11: 120,491,993 E3* probably null Het
Slc7a8 T A 14: 54,735,841 E223V probably benign Het
Snx13 A G 12: 35,144,097 K880E probably benign Het
Spinkl T G 18: 44,168,149 M41L probably benign Het
Srp54a A C 12: 55,089,257 N19T probably benign Het
Sun2 T C 15: 79,734,155 K268E probably benign Het
Sytl1 G A 4: 133,255,624 Q359* probably null Het
Tlr6 A T 5: 64,953,595 F656L probably damaging Het
Tmem185a C T X: 70,462,186 probably null Het
Tmem45a2 C T 16: 57,039,035 D278N probably benign Het
Trav7-1 T C 14: 52,655,334 probably benign Het
Trpc2 T A 7: 102,093,574 M597K probably damaging Het
Ttc21a A G 9: 119,950,816 probably benign Het
Usp9y C T Y: 1,313,741 M2188I probably damaging Het
Utrn C A 10: 12,750,030 probably null Het
Vmn1r35 T A 6: 66,679,073 R204S probably damaging Het
Zfp955b T A 17: 33,305,416 Y59F probably damaging Het
Other mutations in Cyp8b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Cyp8b1 APN 9 121914995 missense probably damaging 0.98
IGL01874:Cyp8b1 APN 9 121915903 missense possibly damaging 0.71
IGL02004:Cyp8b1 APN 9 121914992 missense probably benign 0.01
IGL02218:Cyp8b1 APN 9 121915117 missense probably damaging 1.00
IGL02606:Cyp8b1 APN 9 121915735 missense probably damaging 1.00
IGL02724:Cyp8b1 APN 9 121915387 missense probably benign 0.12
IGL02796:Cyp8b1 UTSW 9 121915498 missense probably benign
R1052:Cyp8b1 UTSW 9 121915282 missense possibly damaging 0.67
R1223:Cyp8b1 UTSW 9 121915004 missense possibly damaging 0.71
R1572:Cyp8b1 UTSW 9 121914958 missense possibly damaging 0.94
R1639:Cyp8b1 UTSW 9 121914890 missense probably benign 0.01
R3833:Cyp8b1 UTSW 9 121916043 missense probably benign 0.00
R4151:Cyp8b1 UTSW 9 121916068 missense probably damaging 1.00
R4615:Cyp8b1 UTSW 9 121916098 nonsense probably null
R4625:Cyp8b1 UTSW 9 121915585 missense probably damaging 0.99
R5327:Cyp8b1 UTSW 9 121914884 missense probably damaging 0.99
R6391:Cyp8b1 UTSW 9 121915798 nonsense probably null
R6998:Cyp8b1 UTSW 9 121915993 missense probably benign
R7086:Cyp8b1 UTSW 9 121915289 missense probably benign 0.02
R7162:Cyp8b1 UTSW 9 121915711 missense probably damaging 0.99
R7210:Cyp8b1 UTSW 9 121915180 missense probably damaging 1.00
R7223:Cyp8b1 UTSW 9 121915097 missense probably damaging 1.00
R8352:Cyp8b1 UTSW 9 121915931 missense probably damaging 0.97
R8392:Cyp8b1 UTSW 9 121915234 missense probably damaging 0.98
R8452:Cyp8b1 UTSW 9 121915931 missense probably damaging 0.97
R8672:Cyp8b1 UTSW 9 121914920 missense probably benign 0.00
R8897:Cyp8b1 UTSW 9 121916292 start gained probably benign
RF013:Cyp8b1 UTSW 9 121915495 missense possibly damaging 0.59
Z1177:Cyp8b1 UTSW 9 121915531 missense probably benign 0.06
Z1177:Cyp8b1 UTSW 9 121916146 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGCATGGATGAAGCTATTC -3'
(R):5'- AACTCAACCAGGCCATGCTG -3'

Sequencing Primer
(F):5'- CATGGATGAAGCTATTCCTTGC -3'
(R):5'- ACAGCCTATCCTTGGTGATGCTAG -3'
Posted On 2015-04-17