Incidental Mutation 'R3938:Nemp1'
ID 307290
Institutional Source Beutler Lab
Gene Symbol Nemp1
Ensembl Gene ENSMUSG00000040195
Gene Name nuclear envelope integral membrane protein 1
Synonyms Tmem194
MMRRC Submission 040825-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R3938 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 127666901-127701049 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 127695473 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 311 (L311P)
Ref Sequence ENSEMBL: ENSMUSP00000113473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048099] [ENSMUST00000118612] [ENSMUST00000118728]
AlphaFold Q6ZQE4
Predicted Effect probably damaging
Transcript: ENSMUST00000048099
AA Change: L360P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045988
Gene: ENSMUSG00000040195
AA Change: L360P

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:DUF2215 150 396 1.2e-94 PFAM
low complexity region 416 426 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118612
SMART Domains Protein: ENSMUSP00000113337
Gene: ENSMUSG00000040195

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:DUF2215 149 325 4.2e-70 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118728
AA Change: L311P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113473
Gene: ENSMUSG00000040195
AA Change: L311P

DomainStartEndE-ValueType
Pfam:DUF2215 100 348 7.2e-105 PFAM
low complexity region 367 377 N/A INTRINSIC
Meta Mutation Damage Score 0.9267 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,154,294 P1561L probably damaging Het
Adamts1 C T 16: 85,795,619 V634M possibly damaging Het
Arid4b A T 13: 14,186,928 N659I probably benign Het
BC049715 T C 6: 136,840,455 I231T possibly damaging Het
Bmp4 T C 14: 46,384,079 Y336C probably damaging Het
Ccdc30 G A 4: 119,352,673 T293I probably benign Het
Chd5 A T 4: 152,377,055 T1275S probably benign Het
Chtf8 A T 8: 106,885,905 M134K probably benign Het
Col11a2 A T 17: 34,039,625 probably benign Het
Cyp8b1 A G 9: 121,915,618 V216A probably benign Het
Dnah8 C T 17: 30,854,937 T4527M probably damaging Het
Elavl3 A G 9: 22,018,744 V288A probably damaging Het
Erap1 T A 13: 74,668,028 L92Q probably damaging Het
Exoc3l G T 8: 105,293,405 P296H probably damaging Het
Gm5294 A T 5: 138,820,968 N78Y probably damaging Het
Hacl1 T C 14: 31,634,191 probably benign Het
Hrnr T A 3: 93,322,855 N133K probably benign Het
Itgax G T 7: 128,136,273 R504S possibly damaging Het
Itgb4 A G 11: 116,005,926 S1461G possibly damaging Het
Klkb1 G T 8: 45,282,801 T175K probably damaging Het
Lrrk2 A T 15: 91,712,780 D525V possibly damaging Het
Lrrk2 C A 15: 91,778,504 T1912K probably damaging Het
Mdga1 G T 17: 29,857,622 Q59K probably damaging Het
Mpp4 A G 1: 59,124,683 V466A possibly damaging Het
Myh6 T C 14: 54,963,055 D203G probably benign Het
Myo5b T C 18: 74,716,037 S1116P probably damaging Het
Nup205 A G 6: 35,219,742 R1138G probably damaging Het
Nup54 A G 5: 92,417,529 M443T probably damaging Het
Peak1 T C 9: 56,260,365 E93G probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plekhj1 A G 10: 80,797,775 I76T probably damaging Het
Poll A G 19: 45,558,418 probably benign Het
Ppp1r3a A T 6: 14,719,074 S614T probably damaging Het
Pygm A T 19: 6,392,950 I556F probably benign Het
Ranbp2 T C 10: 58,476,472 F1005L probably benign Het
Rcor3 G T 1: 192,101,085 T361K possibly damaging Het
Robo4 A G 9: 37,402,017 probably benign Het
Rps15 T C 10: 80,293,839 V96A probably benign Het
Rrm2 T A 12: 24,709,432 N55K probably damaging Het
Shank2 T C 7: 144,128,375 Y382H probably benign Het
Slc25a10 G T 11: 120,491,993 E3* probably null Het
Slc7a8 T A 14: 54,735,841 E223V probably benign Het
Snx13 A G 12: 35,144,097 K880E probably benign Het
Spinkl T G 18: 44,168,149 M41L probably benign Het
Srp54a A C 12: 55,089,257 N19T probably benign Het
Sun2 T C 15: 79,734,155 K268E probably benign Het
Sytl1 G A 4: 133,255,624 Q359* probably null Het
Tlr6 A T 5: 64,953,595 F656L probably damaging Het
Tmem185a C T X: 70,462,186 probably null Het
Tmem45a2 C T 16: 57,039,035 D278N probably benign Het
Trav7-1 T C 14: 52,655,334 probably benign Het
Trpc2 T A 7: 102,093,574 M597K probably damaging Het
Ttc21a A G 9: 119,950,816 probably benign Het
Usp9y C T Y: 1,313,741 M2188I probably damaging Het
Utrn C A 10: 12,750,030 probably null Het
Vmn1r35 T A 6: 66,679,073 R204S probably damaging Het
Zfp955b T A 17: 33,305,416 Y59F probably damaging Het
Other mutations in Nemp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02172:Nemp1 APN 10 127692999 missense probably benign 0.02
Assassin UTSW 10 127689343 nonsense probably null
Brightside UTSW 10 127689450 splice site probably null
Cheery UTSW 10 127677198 missense possibly damaging 0.86
PIT4453001:Nemp1 UTSW 10 127696254 missense probably benign 0.00
R0815:Nemp1 UTSW 10 127693024 missense probably damaging 0.99
R1719:Nemp1 UTSW 10 127696248 missense probably damaging 1.00
R2007:Nemp1 UTSW 10 127693577 missense probably benign 0.02
R2042:Nemp1 UTSW 10 127696334 missense possibly damaging 0.46
R4548:Nemp1 UTSW 10 127696344 missense probably benign 0.00
R4726:Nemp1 UTSW 10 127694593 missense probably benign 0.01
R4981:Nemp1 UTSW 10 127693530 missense probably damaging 1.00
R5048:Nemp1 UTSW 10 127690935 critical splice donor site probably null
R5784:Nemp1 UTSW 10 127677198 missense possibly damaging 0.86
R6073:Nemp1 UTSW 10 127689243 missense probably benign 0.01
R6171:Nemp1 UTSW 10 127689450 splice site probably null
R6294:Nemp1 UTSW 10 127694522 missense possibly damaging 0.87
R7249:Nemp1 UTSW 10 127693526 missense probably damaging 1.00
R7269:Nemp1 UTSW 10 127695476 missense probably damaging 1.00
R7316:Nemp1 UTSW 10 127689343 nonsense probably null
R7468:Nemp1 UTSW 10 127693054 missense possibly damaging 0.56
R7998:Nemp1 UTSW 10 127693489 missense probably damaging 1.00
R8342:Nemp1 UTSW 10 127693029 missense probably benign 0.00
R8672:Nemp1 UTSW 10 127677119 missense probably benign
R8756:Nemp1 UTSW 10 127692976 missense probably benign 0.30
R9228:Nemp1 UTSW 10 127689358 missense possibly damaging 0.85
X0011:Nemp1 UTSW 10 127689311 nonsense probably null
Z1177:Nemp1 UTSW 10 127693519 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAGCTGGGTGATGACTGTCG -3'
(R):5'- GCTCCTAGGTGAGCAATAATCAAAG -3'

Sequencing Primer
(F):5'- TGTCTCCTGGGACAAGTGGAC -3'
(R):5'- GGGCAAAATACAACACTGTTATCTGG -3'
Posted On 2015-04-17