Incidental Mutation 'R3938:Slc25a10'
ID307291
Institutional Source Beutler Lab
Gene Symbol Slc25a10
Ensembl Gene ENSMUSG00000025792
Gene Namesolute carrier family 25 (mitochondrial carrier, dicarboxylate transporter), member 10
SynonymsDic
MMRRC Submission 040825-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3938 (G1)
Quality Score213
Status Validated
Chromosome11
Chromosomal Location120491840-120499187 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 120491993 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 3 (E3*)
Ref Sequence ENSEMBL: ENSMUSP00000026899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026899] [ENSMUST00000043627]
Predicted Effect probably null
Transcript: ENSMUST00000026899
AA Change: E3*
SMART Domains Protein: ENSMUSP00000026899
Gene: ENSMUSG00000025792
AA Change: E3*

DomainStartEndE-ValueType
Pfam:Mito_carr 5 92 4.1e-20 PFAM
Pfam:Mito_carr 94 191 2e-18 PFAM
Pfam:Mito_carr 195 284 7.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000043627
SMART Domains Protein: ENSMUSP00000044417
Gene: ENSMUSG00000039640

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
Pfam:Ribosomal_L12_N 64 120 4.5e-13 PFAM
Pfam:Ribosomal_L12 133 201 5.4e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123373
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137619
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138874
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144706
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180595
Meta Mutation Damage Score 0.9711 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that translocate small metabolites across the mitochondrial membrane. The encoded protein exchanges dicarboxylates, such as malate and succinate, for phosphate, sulfate, and other small molecules, thereby providing substrates for metabolic processes including the Krebs cycle and fatty acid synthesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,154,294 P1561L probably damaging Het
Adamts1 C T 16: 85,795,619 V634M possibly damaging Het
Arid4b A T 13: 14,186,928 N659I probably benign Het
BC049715 T C 6: 136,840,455 I231T possibly damaging Het
Bmp4 T C 14: 46,384,079 Y336C probably damaging Het
Ccdc30 G A 4: 119,352,673 T293I probably benign Het
Chd5 A T 4: 152,377,055 T1275S probably benign Het
Chtf8 A T 8: 106,885,905 M134K probably benign Het
Col11a2 A T 17: 34,039,625 probably benign Het
Cyp8b1 A G 9: 121,915,618 V216A probably benign Het
Dnah8 C T 17: 30,854,937 T4527M probably damaging Het
Elavl3 A G 9: 22,018,744 V288A probably damaging Het
Erap1 T A 13: 74,668,028 L92Q probably damaging Het
Exoc3l G T 8: 105,293,405 P296H probably damaging Het
Gm5294 A T 5: 138,820,968 N78Y probably damaging Het
Hacl1 T C 14: 31,634,191 probably benign Het
Hrnr T A 3: 93,322,855 N133K probably benign Het
Itgax G T 7: 128,136,273 R504S possibly damaging Het
Itgb4 A G 11: 116,005,926 S1461G possibly damaging Het
Klkb1 G T 8: 45,282,801 T175K probably damaging Het
Lrrk2 A T 15: 91,712,780 D525V possibly damaging Het
Lrrk2 C A 15: 91,778,504 T1912K probably damaging Het
Mdga1 G T 17: 29,857,622 Q59K probably damaging Het
Mpp4 A G 1: 59,124,683 V466A possibly damaging Het
Myh6 T C 14: 54,963,055 D203G probably benign Het
Myo5b T C 18: 74,716,037 S1116P probably damaging Het
Nemp1 T C 10: 127,695,473 L311P probably damaging Het
Nup205 A G 6: 35,219,742 R1138G probably damaging Het
Nup54 A G 5: 92,417,529 M443T probably damaging Het
Peak1 T C 9: 56,260,365 E93G probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plekhj1 A G 10: 80,797,775 I76T probably damaging Het
Poll A G 19: 45,558,418 probably benign Het
Ppp1r3a A T 6: 14,719,074 S614T probably damaging Het
Pygm A T 19: 6,392,950 I556F probably benign Het
Ranbp2 T C 10: 58,476,472 F1005L probably benign Het
Rcor3 G T 1: 192,101,085 T361K possibly damaging Het
Robo4 A G 9: 37,402,017 probably benign Het
Rps15 T C 10: 80,293,839 V96A probably benign Het
Rrm2 T A 12: 24,709,432 N55K probably damaging Het
Shank2 T C 7: 144,128,375 Y382H probably benign Het
Slc7a8 T A 14: 54,735,841 E223V probably benign Het
Snx13 A G 12: 35,144,097 K880E probably benign Het
Spinkl T G 18: 44,168,149 M41L probably benign Het
Srp54a A C 12: 55,089,257 N19T probably benign Het
Sun2 T C 15: 79,734,155 K268E probably benign Het
Sytl1 G A 4: 133,255,624 Q359* probably null Het
Tlr6 A T 5: 64,953,595 F656L probably damaging Het
Tmem185a C T X: 70,462,186 probably null Het
Tmem45a2 C T 16: 57,039,035 D278N probably benign Het
Trav7-1 T C 14: 52,655,334 probably benign Het
Trpc2 T A 7: 102,093,574 M597K probably damaging Het
Ttc21a A G 9: 119,950,816 probably benign Het
Usp9y C T Y: 1,313,741 M2188I probably damaging Het
Utrn C A 10: 12,750,030 probably null Het
Vmn1r35 T A 6: 66,679,073 R204S probably damaging Het
Zfp955b T A 17: 33,305,416 Y59F probably damaging Het
Other mutations in Slc25a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Slc25a10 APN 11 120497107 critical splice donor site probably null
IGL00816:Slc25a10 APN 11 120495150 splice site probably benign
IGL02448:Slc25a10 APN 11 120497053 missense probably benign 0.01
R2291:Slc25a10 UTSW 11 120497074 missense probably benign
R2860:Slc25a10 UTSW 11 120495177 missense probably damaging 0.98
R2861:Slc25a10 UTSW 11 120495177 missense probably damaging 0.98
R4019:Slc25a10 UTSW 11 120497439 missense probably damaging 0.99
R4020:Slc25a10 UTSW 11 120497439 missense probably damaging 0.99
R4457:Slc25a10 UTSW 11 120497089 missense probably benign
R4542:Slc25a10 UTSW 11 120497981 splice site probably null
R5643:Slc25a10 UTSW 11 120496376 intron probably benign
R5869:Slc25a10 UTSW 11 120498117 missense probably damaging 0.98
R6032:Slc25a10 UTSW 11 120494958 critical splice acceptor site probably null
R6032:Slc25a10 UTSW 11 120494958 critical splice acceptor site probably null
R6455:Slc25a10 UTSW 11 120495205 missense probably damaging 1.00
R6574:Slc25a10 UTSW 11 120497077 missense probably benign
R6954:Slc25a10 UTSW 11 120498147 missense probably benign
R7302:Slc25a10 UTSW 11 120491956 unclassified probably benign
R7618:Slc25a10 UTSW 11 120496971 intron probably null
R7671:Slc25a10 UTSW 11 120495460 missense probably benign 0.18
R7883:Slc25a10 UTSW 11 120494514 missense possibly damaging 0.84
R7966:Slc25a10 UTSW 11 120494514 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- CTCTTTAAGACCAGAGGCGG -3'
(R):5'- TAATTACCGGGTGCGCAGTC -3'

Sequencing Primer
(F):5'- CTTTAAGACCAGAGGCGGAGTCTC -3'
(R):5'- TTGAAGCTCAGGCTCACT -3'
Posted On2015-04-17