Incidental Mutation 'R3938:Hacl1'
ID307297
Institutional Source Beutler Lab
Gene Symbol Hacl1
Ensembl Gene ENSMUSG00000021884
Gene Name2-hydroxyacyl-CoA lyase 1
SynonymsHpcl, Phyh2
MMRRC Submission 040825-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3938 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location31598730-31641286 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 31634191 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022437] [ENSMUST00000127204] [ENSMUST00000128629] [ENSMUST00000134626] [ENSMUST00000156431] [ENSMUST00000165955] [ENSMUST00000167066] [ENSMUST00000167175] [ENSMUST00000171414]
Predicted Effect probably benign
Transcript: ENSMUST00000022437
SMART Domains Protein: ENSMUSP00000022437
Gene: ENSMUSG00000021884

DomainStartEndE-ValueType
Pfam:TPP_enzyme_N 17 185 6.1e-46 PFAM
Pfam:TPP_enzyme_M 206 335 1.9e-34 PFAM
Pfam:TPP_enzyme_C 400 560 1.6e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127204
SMART Domains Protein: ENSMUSP00000120452
Gene: ENSMUSG00000021884

DomainStartEndE-ValueType
Pfam:TPP_enzyme_N 17 81 1.3e-14 PFAM
Pfam:TPP_enzyme_N 75 159 3.3e-14 PFAM
Pfam:TPP_enzyme_M 179 310 1.5e-34 PFAM
Pfam:TPP_enzyme_C 373 533 7.2e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128629
SMART Domains Protein: ENSMUSP00000125890
Gene: ENSMUSG00000021884

DomainStartEndE-ValueType
Pfam:TPP_enzyme_N 10 58 2.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134626
SMART Domains Protein: ENSMUSP00000114879
Gene: ENSMUSG00000021884

DomainStartEndE-ValueType
Pfam:TPP_enzyme_N 17 67 3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135751
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155210
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156189
Predicted Effect probably benign
Transcript: ENSMUST00000156431
SMART Domains Protein: ENSMUSP00000114922
Gene: ENSMUSG00000021884

DomainStartEndE-ValueType
Pfam:TPP_enzyme_N 17 186 3.3e-46 PFAM
Pfam:TPP_enzyme_M 206 337 2.1e-34 PFAM
Pfam:TPP_enzyme_C 400 560 1.6e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165955
SMART Domains Protein: ENSMUSP00000129090
Gene: ENSMUSG00000021884

DomainStartEndE-ValueType
Pfam:TPP_enzyme_N 17 105 3.7e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167066
SMART Domains Protein: ENSMUSP00000132913
Gene: ENSMUSG00000021884

DomainStartEndE-ValueType
Pfam:TPP_enzyme_N 17 131 2.5e-33 PFAM
Pfam:TPP_enzyme_M 180 311 4.7e-34 PFAM
Pfam:TPP_enzyme_C 340 500 6.4e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167175
SMART Domains Protein: ENSMUSP00000128588
Gene: ENSMUSG00000115022

DomainStartEndE-ValueType
Pfam:TPP_enzyme_N 17 139 3.6e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171414
SMART Domains Protein: ENSMUSP00000130268
Gene: ENSMUSG00000021884

DomainStartEndE-ValueType
Pfam:TPP_enzyme_N 17 109 1.3e-27 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,154,294 P1561L probably damaging Het
Adamts1 C T 16: 85,795,619 V634M possibly damaging Het
Arid4b A T 13: 14,186,928 N659I probably benign Het
BC049715 T C 6: 136,840,455 I231T possibly damaging Het
Bmp4 T C 14: 46,384,079 Y336C probably damaging Het
Ccdc30 G A 4: 119,352,673 T293I probably benign Het
Chd5 A T 4: 152,377,055 T1275S probably benign Het
Chtf8 A T 8: 106,885,905 M134K probably benign Het
Col11a2 A T 17: 34,039,625 probably benign Het
Cyp8b1 A G 9: 121,915,618 V216A probably benign Het
Dnah8 C T 17: 30,854,937 T4527M probably damaging Het
Elavl3 A G 9: 22,018,744 V288A probably damaging Het
Erap1 T A 13: 74,668,028 L92Q probably damaging Het
Exoc3l G T 8: 105,293,405 P296H probably damaging Het
Gm5294 A T 5: 138,820,968 N78Y probably damaging Het
Hrnr T A 3: 93,322,855 N133K probably benign Het
Itgax G T 7: 128,136,273 R504S possibly damaging Het
Itgb4 A G 11: 116,005,926 S1461G possibly damaging Het
Klkb1 G T 8: 45,282,801 T175K probably damaging Het
Lrrk2 A T 15: 91,712,780 D525V possibly damaging Het
Lrrk2 C A 15: 91,778,504 T1912K probably damaging Het
Mdga1 G T 17: 29,857,622 Q59K probably damaging Het
Mpp4 A G 1: 59,124,683 V466A possibly damaging Het
Myh6 T C 14: 54,963,055 D203G probably benign Het
Myo5b T C 18: 74,716,037 S1116P probably damaging Het
Nemp1 T C 10: 127,695,473 L311P probably damaging Het
Nup205 A G 6: 35,219,742 R1138G probably damaging Het
Nup54 A G 5: 92,417,529 M443T probably damaging Het
Peak1 T C 9: 56,260,365 E93G probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plekhj1 A G 10: 80,797,775 I76T probably damaging Het
Poll A G 19: 45,558,418 probably benign Het
Ppp1r3a A T 6: 14,719,074 S614T probably damaging Het
Pygm A T 19: 6,392,950 I556F probably benign Het
Ranbp2 T C 10: 58,476,472 F1005L probably benign Het
Rcor3 G T 1: 192,101,085 T361K possibly damaging Het
Robo4 A G 9: 37,402,017 probably benign Het
Rps15 T C 10: 80,293,839 V96A probably benign Het
Rrm2 T A 12: 24,709,432 N55K probably damaging Het
Shank2 T C 7: 144,128,375 Y382H probably benign Het
Slc25a10 G T 11: 120,491,993 E3* probably null Het
Slc7a8 T A 14: 54,735,841 E223V probably benign Het
Snx13 A G 12: 35,144,097 K880E probably benign Het
Spinkl T G 18: 44,168,149 M41L probably benign Het
Srp54a A C 12: 55,089,257 N19T probably benign Het
Sun2 T C 15: 79,734,155 K268E probably benign Het
Sytl1 G A 4: 133,255,624 Q359* probably null Het
Tlr6 A T 5: 64,953,595 F656L probably damaging Het
Tmem185a C T X: 70,462,186 probably null Het
Tmem45a2 C T 16: 57,039,035 D278N probably benign Het
Trav7-1 T C 14: 52,655,334 probably benign Het
Trpc2 T A 7: 102,093,574 M597K probably damaging Het
Ttc21a A G 9: 119,950,816 probably benign Het
Usp9y C T Y: 1,313,741 M2188I probably damaging Het
Utrn C A 10: 12,750,030 probably null Het
Vmn1r35 T A 6: 66,679,073 R204S probably damaging Het
Zfp955b T A 17: 33,305,416 Y59F probably damaging Het
Other mutations in Hacl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Hacl1 APN 14 31626417 missense probably benign 0.04
IGL01548:Hacl1 APN 14 31640596 missense possibly damaging 0.78
IGL01952:Hacl1 APN 14 31641122 unclassified probably benign
IGL02059:Hacl1 APN 14 31632934 missense probably benign 0.00
IGL02138:Hacl1 APN 14 31630983 missense probably benign 0.05
IGL02637:Hacl1 APN 14 31640501 missense probably damaging 1.00
IGL03235:Hacl1 APN 14 31631038 nonsense probably null
R0502:Hacl1 UTSW 14 31622984 splice site probably benign
R1697:Hacl1 UTSW 14 31621000 splice site probably null
R1800:Hacl1 UTSW 14 31614264 missense probably damaging 1.00
R1829:Hacl1 UTSW 14 31640534 missense probably benign 0.00
R3937:Hacl1 UTSW 14 31634191 splice site probably benign
R5004:Hacl1 UTSW 14 31619039 missense probably benign
R5776:Hacl1 UTSW 14 31622871 missense possibly damaging 0.90
R5868:Hacl1 UTSW 14 31619916 missense probably damaging 1.00
R5929:Hacl1 UTSW 14 31616388 missense probably benign 0.04
R6261:Hacl1 UTSW 14 31635771 missense probably damaging 1.00
R6996:Hacl1 UTSW 14 31615423 missense possibly damaging 0.96
R7298:Hacl1 UTSW 14 31616486 missense probably damaging 1.00
R7768:Hacl1 UTSW 14 31616480 missense probably damaging 1.00
R7887:Hacl1 UTSW 14 31634227 missense probably damaging 1.00
R8384:Hacl1 UTSW 14 31634197 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTTAACTACTGTCCTCACGCAG -3'
(R):5'- ATTCCGAGCTGAGATTGCTGG -3'

Sequencing Primer
(F):5'- GAATGAACGTTTGCACCGTTC -3'
(R):5'- GATCCATGACCTCTGCTTT -3'
Posted On2015-04-17