Incidental Mutation 'R3938:Tmem185a'
ID 307316
Institutional Source Beutler Lab
Gene Symbol Tmem185a
Ensembl Gene ENSMUSG00000073139
Gene Name transmembrane protein 185A
Synonyms BC023829
MMRRC Submission 040825-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R3938 (G1)
Quality Score 222
Status Validated
Chromosome X
Chromosomal Location 70459753-70477180 bp(-) (GRCm38)
Type of Mutation splice site (5 bp from exon)
DNA Base Change (assembly) C to T at 70462186 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101506] [ENSMUST00000114630]
AlphaFold A2AF53
Predicted Effect probably null
Transcript: ENSMUST00000101506
SMART Domains Protein: ENSMUSP00000099043
Gene: ENSMUSG00000073139

DomainStartEndE-ValueType
Pfam:Tmemb_185A 30 141 9.5e-38 PFAM
Pfam:Tmemb_185A 137 225 4.2e-22 PFAM
low complexity region 277 288 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114630
SMART Domains Protein: ENSMUSP00000110277
Gene: ENSMUSG00000073139

DomainStartEndE-ValueType
Pfam:Tmemb_185A 30 253 6.5e-65 PFAM
low complexity region 305 316 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154400
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is predicted to be a transmembrane protein. This gene is best known for localizing to the CpG island of the fragile site FRAXF. The 5' untranslated region of this gene contains a CGG trinucleotide repeat sequence that normally consists of 7-40 tandem CGG repeats but which can expand to greater than 300 repeats. Methylation of the CpG island leads to transcriptional silencing of this gene, but neither the silencing nor an expanded repeat region appear to manifest itself in a clear phenotypic manner. Alternative splicing results in multiple transcript variants. A pseudogene of this gene has been defined on the X chromosome. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,154,294 P1561L probably damaging Het
Adamts1 C T 16: 85,795,619 V634M possibly damaging Het
Arid4b A T 13: 14,186,928 N659I probably benign Het
BC049715 T C 6: 136,840,455 I231T possibly damaging Het
Bmp4 T C 14: 46,384,079 Y336C probably damaging Het
Ccdc30 G A 4: 119,352,673 T293I probably benign Het
Chd5 A T 4: 152,377,055 T1275S probably benign Het
Chtf8 A T 8: 106,885,905 M134K probably benign Het
Col11a2 A T 17: 34,039,625 probably benign Het
Cyp8b1 A G 9: 121,915,618 V216A probably benign Het
Dnah8 C T 17: 30,854,937 T4527M probably damaging Het
Elavl3 A G 9: 22,018,744 V288A probably damaging Het
Erap1 T A 13: 74,668,028 L92Q probably damaging Het
Exoc3l G T 8: 105,293,405 P296H probably damaging Het
Gm5294 A T 5: 138,820,968 N78Y probably damaging Het
Hacl1 T C 14: 31,634,191 probably benign Het
Hrnr T A 3: 93,322,855 N133K probably benign Het
Itgax G T 7: 128,136,273 R504S possibly damaging Het
Itgb4 A G 11: 116,005,926 S1461G possibly damaging Het
Klkb1 G T 8: 45,282,801 T175K probably damaging Het
Lrrk2 A T 15: 91,712,780 D525V possibly damaging Het
Lrrk2 C A 15: 91,778,504 T1912K probably damaging Het
Mdga1 G T 17: 29,857,622 Q59K probably damaging Het
Mpp4 A G 1: 59,124,683 V466A possibly damaging Het
Myh6 T C 14: 54,963,055 D203G probably benign Het
Myo5b T C 18: 74,716,037 S1116P probably damaging Het
Nemp1 T C 10: 127,695,473 L311P probably damaging Het
Nup205 A G 6: 35,219,742 R1138G probably damaging Het
Nup54 A G 5: 92,417,529 M443T probably damaging Het
Peak1 T C 9: 56,260,365 E93G probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plekhj1 A G 10: 80,797,775 I76T probably damaging Het
Poll A G 19: 45,558,418 probably benign Het
Ppp1r3a A T 6: 14,719,074 S614T probably damaging Het
Pygm A T 19: 6,392,950 I556F probably benign Het
Ranbp2 T C 10: 58,476,472 F1005L probably benign Het
Rcor3 G T 1: 192,101,085 T361K possibly damaging Het
Robo4 A G 9: 37,402,017 probably benign Het
Rps15 T C 10: 80,293,839 V96A probably benign Het
Rrm2 T A 12: 24,709,432 N55K probably damaging Het
Shank2 T C 7: 144,128,375 Y382H probably benign Het
Slc25a10 G T 11: 120,491,993 E3* probably null Het
Slc7a8 T A 14: 54,735,841 E223V probably benign Het
Snx13 A G 12: 35,144,097 K880E probably benign Het
Spinkl T G 18: 44,168,149 M41L probably benign Het
Srp54a A C 12: 55,089,257 N19T probably benign Het
Sun2 T C 15: 79,734,155 K268E probably benign Het
Sytl1 G A 4: 133,255,624 Q359* probably null Het
Tlr6 A T 5: 64,953,595 F656L probably damaging Het
Tmem45a2 C T 16: 57,039,035 D278N probably benign Het
Trav7-1 T C 14: 52,655,334 probably benign Het
Trpc2 T A 7: 102,093,574 M597K probably damaging Het
Ttc21a A G 9: 119,950,816 probably benign Het
Usp9y C T Y: 1,313,741 M2188I probably damaging Het
Utrn C A 10: 12,750,030 probably null Het
Vmn1r35 T A 6: 66,679,073 R204S probably damaging Het
Zfp955b T A 17: 33,305,416 Y59F probably damaging Het
Other mutations in Tmem185a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00845:Tmem185a APN X 70462317 splice site probably null
R3937:Tmem185a UTSW X 70462186 splice site probably null
Predicted Primers PCR Primer
(F):5'- CGCTCACAGCCTTATGAGAATG -3'
(R):5'- TGGGAACAGTTACACATTTGGTTC -3'

Sequencing Primer
(F):5'- GCTCACAGCCTTATGAGAATGGTATC -3'
(R):5'- CAAACTGGATGGCCACAA -3'
Posted On 2015-04-17