Incidental Mutation 'R3917:Gm14124'
ID307323
Institutional Source Beutler Lab
Gene Symbol Gm14124
Ensembl Gene ENSMUSG00000079008
Gene Namepredicted gene 14124
Synonyms
MMRRC Submission 040914-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R3917 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location150257517-150270300 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 150266119 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109922]
Predicted Effect probably benign
Transcript: ENSMUST00000109922
SMART Domains Protein: ENSMUSP00000105548
Gene: ENSMUSG00000079008

DomainStartEndE-ValueType
KRAB 4 66 9.26e-19 SMART
ZnF_C2H2 103 125 7.49e-5 SMART
ZnF_C2H2 131 151 9.46e0 SMART
ZnF_C2H2 159 181 5.9e-3 SMART
ZnF_C2H2 187 209 6.67e-2 SMART
ZnF_C2H2 215 237 4.87e-4 SMART
ZnF_C2H2 243 265 2.82e0 SMART
ZnF_C2H2 271 293 2.2e2 SMART
ZnF_C2H2 299 321 1.4e-4 SMART
ZnF_C2H2 327 349 1.6e-4 SMART
ZnF_C2H2 355 377 1.18e-2 SMART
ZnF_C2H2 383 405 1.38e-3 SMART
ZnF_C2H2 411 433 9.56e1 SMART
ZnF_C2H2 439 461 6.99e-5 SMART
ZnF_C2H2 467 489 2.99e-4 SMART
ZnF_C2H2 495 517 7.78e-3 SMART
ZnF_C2H2 523 545 1.04e-3 SMART
ZnF_C2H2 551 573 1.6e-4 SMART
ZnF_C2H2 579 601 1.18e-2 SMART
ZnF_C2H2 607 629 4.54e-4 SMART
ZnF_C2H2 635 657 4.24e-4 SMART
ZnF_C2H2 663 685 1.2e-3 SMART
ZnF_C2H2 691 713 8.47e-4 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 97% (74/76)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad12 A G 5: 121,599,214 V498A probably damaging Het
Adam19 A G 11: 46,060,935 E37G probably benign Het
Apol11b A G 15: 77,635,304 I192T probably benign Het
Appl1 A T 14: 26,928,604 F537Y probably damaging Het
Atad5 A C 11: 80,103,294 K785N probably null Het
Atp1b2 A G 11: 69,603,075 V93A probably damaging Het
Bcam T C 7: 19,765,450 Y216C probably damaging Het
Brca2 A G 5: 150,540,827 E1352G probably damaging Het
C030005K15Rik A C 10: 97,725,591 S93A unknown Het
Cadps C T 14: 12,457,702 A1060T probably benign Het
Ccdc88c A G 12: 100,941,107 probably null Het
Ccdc89 A G 7: 90,426,825 D81G probably damaging Het
Ccnt1 A G 15: 98,544,059 S443P probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdc42bpa T C 1: 180,106,154 probably null Het
Cdk11b T C 4: 155,626,801 S47P probably damaging Het
Cfap43 T C 19: 47,897,750 D142G probably benign Het
Cntnap4 C G 8: 112,875,533 P1190A probably benign Het
Colgalt2 T A 1: 152,508,611 Y567* probably null Het
Dner CGCTGCTGCTGCTGCTGCTGCTGCTGC CGCTGCTGCTGCTGCTGCTGCTGC 1: 84,585,549 probably benign Het
Dock7 T C 4: 99,016,685 Y651C probably damaging Het
Fzd3 A T 14: 65,235,930 F130I probably damaging Het
Gabarapl2 T A 8: 111,952,396 F115L probably benign Het
Gm1043 G A 5: 37,192,941 probably benign Het
Gm12185 A G 11: 48,915,933 F144L probably benign Het
Gm21961 A T 15: 65,014,884 D7E unknown Het
Gtf3a A G 5: 146,955,434 K332E probably benign Het
Haao A G 17: 83,838,799 probably null Het
Habp2 T A 19: 56,311,179 C170S probably damaging Het
Heatr3 T G 8: 88,150,371 probably null Het
Herc1 T G 9: 66,434,466 C1846G possibly damaging Het
Hivep3 T C 4: 120,099,427 S1647P probably benign Het
Hnrnpul1 C T 7: 25,726,875 R517Q probably damaging Het
Hspg2 A G 4: 137,559,314 E3648G probably damaging Het
Jaml T C 9: 45,101,151 probably benign Het
Jund C T 8: 70,699,023 probably benign Het
Klra14-ps T C 6: 130,157,632 noncoding transcript Het
Krt88 G A 15: 101,452,928 probably null Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Lyzl4 T A 9: 121,583,035 D105V probably damaging Het
Mst1 A G 9: 108,084,295 I575V probably benign Het
Myd88 T C 9: 119,341,398 probably benign Het
Myo1d A T 11: 80,666,578 V512E probably damaging Het
Ndufv1 A G 19: 4,010,002 Y33H probably damaging Het
Nwd1 T A 8: 72,667,811 C608* probably null Het
Olfr118 T A 17: 37,672,793 F257I probably damaging Het
Olfr884 A T 9: 38,047,545 I108F probably damaging Het
Patj A T 4: 98,592,008 K1317* probably null Het
Pld5 A G 1: 175,963,938 S501P probably benign Het
Pnpo A G 11: 96,939,757 V146A probably damaging Het
Ppdpf A G 2: 181,187,728 Y16C probably benign Het
Ppp1r27 A G 11: 120,550,959 V32A possibly damaging Het
Rbm28 T C 6: 29,154,789 D294G probably benign Het
Sdk1 T A 5: 142,051,244 D817E probably damaging Het
Shank3 A G 15: 89,503,384 D252G possibly damaging Het
Slc29a1 A T 17: 45,588,973 probably null Het
Slc35a5 G C 16: 45,158,158 probably benign Het
Slc6a5 T C 7: 49,911,869 S50P probably damaging Het
Slfn8 A T 11: 83,016,993 Y241* probably null Het
Slu7 G T 11: 43,440,684 probably null Het
Smad2 T A 18: 76,287,937 D82E probably benign Het
Spx A C 6: 142,414,031 E33A probably damaging Het
Tdp1 A G 12: 99,894,717 Y205C probably damaging Het
Tekt1 A G 11: 72,345,748 I296T possibly damaging Het
Tgm1 G A 14: 55,712,757 probably benign Het
Tnks A G 8: 34,853,361 S719P probably damaging Het
Trip6 A G 5: 137,313,679 C47R probably benign Het
Trpv3 A G 11: 73,283,734 D309G possibly damaging Het
Tti2 A G 8: 31,153,519 K221E possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn1r57 A T 7: 5,220,631 N52Y probably damaging Het
Vmn2r94 A G 17: 18,244,358 F557L probably benign Het
Zbed5 T C 5: 129,902,277 Y356H possibly damaging Het
Zic4 C A 9: 91,384,341 probably benign Het
Other mutations in Gm14124
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01550:Gm14124 APN 2 150266443 splice site probably benign
R0220:Gm14124 UTSW 2 150268675 missense unknown
R0396:Gm14124 UTSW 2 150268053 missense probably damaging 1.00
R0402:Gm14124 UTSW 2 150269216 missense possibly damaging 0.93
R0446:Gm14124 UTSW 2 150268073 missense possibly damaging 0.71
R0462:Gm14124 UTSW 2 150269202 missense possibly damaging 0.80
R0507:Gm14124 UTSW 2 150268124 missense possibly damaging 0.69
R0605:Gm14124 UTSW 2 150268603 missense unknown
R0838:Gm14124 UTSW 2 150269300 missense possibly damaging 0.74
R1327:Gm14124 UTSW 2 150266150 missense possibly damaging 0.71
R1405:Gm14124 UTSW 2 150267700 nonsense probably null
R1405:Gm14124 UTSW 2 150267700 nonsense probably null
R2114:Gm14124 UTSW 2 150267899 missense unknown
R2140:Gm14124 UTSW 2 150269361 missense probably benign 0.33
R3683:Gm14124 UTSW 2 150268056 missense probably benign 0.41
R4084:Gm14124 UTSW 2 150266202 missense possibly damaging 0.85
R4499:Gm14124 UTSW 2 150269442 missense possibly damaging 0.93
R4683:Gm14124 UTSW 2 150266470 missense possibly damaging 0.53
R4762:Gm14124 UTSW 2 150267629 missense possibly damaging 0.53
R4937:Gm14124 UTSW 2 150268760 missense unknown
R5678:Gm14124 UTSW 2 150268505 nonsense probably null
R5696:Gm14124 UTSW 2 150269474 missense possibly damaging 0.52
R5697:Gm14124 UTSW 2 150269474 missense possibly damaging 0.52
R5698:Gm14124 UTSW 2 150269474 missense possibly damaging 0.52
R5769:Gm14124 UTSW 2 150268278 missense possibly damaging 0.87
R5780:Gm14124 UTSW 2 150266219 missense probably benign 0.05
R5973:Gm14124 UTSW 2 150267935 missense unknown
R6662:Gm14124 UTSW 2 150266252 critical splice donor site probably null
R6878:Gm14124 UTSW 2 150266486 missense possibly damaging 0.86
R7037:Gm14124 UTSW 2 150266456 missense possibly damaging 0.86
R7081:Gm14124 UTSW 2 150268269 missense possibly damaging 0.66
R7413:Gm14124 UTSW 2 150266161 missense possibly damaging 0.93
R7725:Gm14124 UTSW 2 150268548 missense unknown
R7781:Gm14124 UTSW 2 150267657 missense possibly damaging 0.53
X0022:Gm14124 UTSW 2 150267658 missense possibly damaging 0.53
Z1177:Gm14124 UTSW 2 150268317 missense possibly damaging 0.84
Z1177:Gm14124 UTSW 2 150268324 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGATACACCTGGGTCTGCCT -3'
(R):5'- CTCAACGGAAATTACAAGAACAAGTA -3'

Sequencing Primer
(F):5'- TCCTCTTCAAGGGGTGTAGAAATGAC -3'
(R):5'- GTCTCCAGCATCACATCT -3'
Posted On2015-04-17