Mutagenetix > Incidental Mutations

Incidental Mutation 'R3917:Ugcg'

307325

Institutional Source

Beutler Lab

Gene Symbol

Ugcg

Ensembl Gene

ENSMUSG00000028381

Gene Name

UDP-glucose ceramide glucosyltransferase

Synonyms

Epcs21, Ugcgl, GlcT-1

MMRRC Submission

040914-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3917 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

59189257-59222833 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 59207798 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 46 (P46S)

Ref Sequence

ENSEMBL: ENSMUSP00000030074 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030074]

Predicted Effect

probably benign
Transcript: ENSMUST00000030074
AA Change: P46S

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000030074
Gene: ENSMUSG00000028381
AA Change: P46S

Domain	Start	End	E-Value	Type
transmembrane domain	10	32	N/A	INTRINSIC
Pfam:Glyco_tranf_2_3	51	278	1.3e-26	PFAM
Pfam:Glyco_transf_21	106	278	8.4e-61	PFAM
Pfam:Glyco_trans_2_3	139	368	9.6e-13	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128227

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133996

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155153

Meta Mutation Damage Score

0.0799

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.0%

Validation Efficiency

97% (74/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the first glycosylation step in the biosynthesis of glycosphingolipids, which are membrane components containing lipid and sugar moieties. The product of this reaction is glucosylceramide, which is the core structure of many glycosphingolipids. [provided by RefSeq, Dec 2014]
PHENOTYPE: At embryonic day 7.5, embryos homozygous for a null mutation exhibit decreased size, markedly reduced extraembryonic tissues and a large increase in cells undergoing apoptosis. Mutants die by embryonic day 8.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acad12	A	G	5: 121,599,214	V498A	probably damaging	Het
Adam19	A	G	11: 46,060,935	E37G	probably benign	Het
Apol11b	A	G	15: 77,635,304	I192T	probably benign	Het
Appl1	A	T	14: 26,928,604	F537Y	probably damaging	Het
Atad5	A	C	11: 80,103,294	K785N	probably null	Het
Atp1b2	A	G	11: 69,603,075	V93A	probably damaging	Het
Bcam	T	C	7: 19,765,450	Y216C	probably damaging	Het
Brca2	A	G	5: 150,540,827	E1352G	probably damaging	Het
C030005K15Rik	A	C	10: 97,725,591	S93A	unknown	Het
Cadps	C	T	14: 12,457,702	A1060T	probably benign	Het
Ccdc88c	A	G	12: 100,941,107		probably null	Het
Ccdc89	A	G	7: 90,426,825	D81G	probably damaging	Het
Ccnt1	A	G	15: 98,544,059	S443P	probably benign	Het
Cd109	CATTTATTTATTTATTTATTTATTTATTTATTTAT	CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT	9: 78,712,500		probably benign	Het
Cdc42bpa	T	C	1: 180,106,154		probably null	Het
Cdk11b	T	C	4: 155,626,801	S47P	probably damaging	Het
Cfap43	T	C	19: 47,897,750	D142G	probably benign	Het
Cntnap4	C	G	8: 112,875,533	P1190A	probably benign	Het
Colgalt2	T	A	1: 152,508,611	Y567*	probably null	Het
Dner	CGCTGCTGCTGCTGCTGCTGCTGCTGC	CGCTGCTGCTGCTGCTGCTGCTGC	1: 84,585,549		probably benign	Het
Dock7	T	C	4: 99,016,685	Y651C	probably damaging	Het
Fzd3	A	T	14: 65,235,930	F130I	probably damaging	Het
Gabarapl2	T	A	8: 111,952,396	F115L	probably benign	Het
Gm1043	G	A	5: 37,192,941		probably benign	Het
Gm12185	A	G	11: 48,915,933	F144L	probably benign	Het
Gm14124	T	A	2: 150,266,119		probably benign	Het
Gm21961	A	T	15: 65,014,884	D7E	unknown	Het
Gtf3a	A	G	5: 146,955,434	K332E	probably benign	Het
Haao	A	G	17: 83,838,799		probably null	Het
Habp2	T	A	19: 56,311,179	C170S	probably damaging	Het
Heatr3	T	G	8: 88,150,371		probably null	Het
Herc1	T	G	9: 66,434,466	C1846G	possibly damaging	Het
Hivep3	T	C	4: 120,099,427	S1647P	probably benign	Het
Hnrnpul1	C	T	7: 25,726,875	R517Q	probably damaging	Het
Hspg2	A	G	4: 137,559,314	E3648G	probably damaging	Het
Jaml	T	C	9: 45,101,151		probably benign	Het
Jund	C	T	8: 70,699,023		probably benign	Het
Klra14-ps	T	C	6: 130,157,632		noncoding transcript	Het
Krt88	G	A	15: 101,452,928		probably null	Het
Lrp5	G	A	19: 3,612,330	R173C	probably damaging	Het
Lyzl4	T	A	9: 121,583,035	D105V	probably damaging	Het
Mst1	A	G	9: 108,084,295	I575V	probably benign	Het
Myd88	T	C	9: 119,341,398		probably benign	Het
Myo1d	A	T	11: 80,666,578	V512E	probably damaging	Het
Ndufv1	A	G	19: 4,010,002	Y33H	probably damaging	Het
Nwd1	T	A	8: 72,667,811	C608*	probably null	Het
Olfr118	T	A	17: 37,672,793	F257I	probably damaging	Het
Olfr884	A	T	9: 38,047,545	I108F	probably damaging	Het
Patj	A	T	4: 98,592,008	K1317*	probably null	Het
Pld5	A	G	1: 175,963,938	S501P	probably benign	Het
Pnpo	A	G	11: 96,939,757	V146A	probably damaging	Het
Ppdpf	A	G	2: 181,187,728	Y16C	probably benign	Het
Ppp1r27	A	G	11: 120,550,959	V32A	possibly damaging	Het
Rbm28	T	C	6: 29,154,789	D294G	probably benign	Het
Sdk1	T	A	5: 142,051,244	D817E	probably damaging	Het
Shank3	A	G	15: 89,503,384	D252G	possibly damaging	Het
Slc29a1	A	T	17: 45,588,973		probably null	Het
Slc35a5	G	C	16: 45,158,158		probably benign	Het
Slc6a5	T	C	7: 49,911,869	S50P	probably damaging	Het
Slfn8	A	T	11: 83,016,993	Y241*	probably null	Het
Slu7	G	T	11: 43,440,684		probably null	Het
Smad2	T	A	18: 76,287,937	D82E	probably benign	Het
Spx	A	C	6: 142,414,031	E33A	probably damaging	Het
Tdp1	A	G	12: 99,894,717	Y205C	probably damaging	Het
Tekt1	A	G	11: 72,345,748	I296T	possibly damaging	Het
Tgm1	G	A	14: 55,712,757		probably benign	Het
Tnks	A	G	8: 34,853,361	S719P	probably damaging	Het
Trip6	A	G	5: 137,313,679	C47R	probably benign	Het
Trpv3	A	G	11: 73,283,734	D309G	possibly damaging	Het
Tti2	A	G	8: 31,153,519	K221E	possibly damaging	Het
Vmn1r57	A	T	7: 5,220,631	N52Y	probably damaging	Het
Vmn2r94	A	G	17: 18,244,358	F557L	probably benign	Het
Zbed5	T	C	5: 129,902,277	Y356H	possibly damaging	Het
Zic4	C	A	9: 91,384,341		probably benign	Het

Other mutations in Ugcg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01447:Ugcg	APN	4	59213865	missense	possibly damaging	0.94
IGL01768:Ugcg	APN	4	59217216	critical splice donor site	probably null
IGL02636:Ugcg	APN	4	59207763	missense	possibly damaging	0.73
IGL02672:Ugcg	APN	4	59218587	splice site	probably benign
IGL02798:Ugcg	APN	4	59220346	missense	probably damaging	1.00
congee	UTSW	4	59207798	missense	probably benign	0.17
Porridge	UTSW	4	59219530	missense	possibly damaging	0.86
slop	UTSW	4	59211883	missense	probably benign	0.16
wheatina	UTSW	4	59220272	missense	probably damaging	0.96
PIT4382001:Ugcg	UTSW	4	59213246	missense	possibly damaging	0.68
R0013:Ugcg	UTSW	4	59213931	missense	possibly damaging	0.82
R0013:Ugcg	UTSW	4	59213931	missense	possibly damaging	0.82
R0068:Ugcg	UTSW	4	59217130	missense	probably benign	0.16
R0068:Ugcg	UTSW	4	59217130	missense	probably benign	0.16
R0119:Ugcg	UTSW	4	59217036	missense	possibly damaging	0.85
R0230:Ugcg	UTSW	4	59189739	nonsense	probably null
R0299:Ugcg	UTSW	4	59217036	missense	possibly damaging	0.85
R0384:Ugcg	UTSW	4	59220387	missense	possibly damaging	0.91
R0499:Ugcg	UTSW	4	59217036	missense	possibly damaging	0.85
R0645:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R0688:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R0726:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R0802:Ugcg	UTSW	4	59189685	missense	probably benign	0.00
R0803:Ugcg	UTSW	4	59189685	missense	probably benign	0.00
R0811:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R0812:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R0828:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R0831:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R0944:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R0945:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R0947:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1104:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1209:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1210:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1252:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1253:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1255:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1488:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1490:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1548:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1698:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1771:Ugcg	UTSW	4	59207775	missense	probably benign	0.05
R1776:Ugcg	UTSW	4	59207775	missense	probably benign	0.05
R1781:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1794:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1840:Ugcg	UTSW	4	59219517	missense	probably damaging	1.00
R1942:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2228:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2229:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2237:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2239:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2314:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2337:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2338:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2340:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2422:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2426:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2433:Ugcg	UTSW	4	59207876	missense	possibly damaging	0.89
R2680:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3076:Ugcg	UTSW	4	59213922	missense	probably damaging	1.00
R3078:Ugcg	UTSW	4	59213922	missense	probably damaging	1.00
R3689:Ugcg	UTSW	4	59211883	missense	probably benign	0.16
R3732:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3732:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3733:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3766:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3767:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3768:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3769:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3771:Ugcg	UTSW	4	59189690	missense	probably benign
R3847:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3848:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3916:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3958:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3959:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R4023:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R4024:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R4025:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R4065:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R4066:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R4427:Ugcg	UTSW	4	59219555	missense	probably benign	0.02
R5842:Ugcg	UTSW	4	59219545	missense	possibly damaging	0.93
R6012:Ugcg	UTSW	4	59220272	missense	probably damaging	0.96
R6080:Ugcg	UTSW	4	59218524	missense	possibly damaging	0.70
R6762:Ugcg	UTSW	4	59219530	missense	possibly damaging	0.86
R7194:Ugcg	UTSW	4	59213210	missense	probably damaging	0.99
R7286:Ugcg	UTSW	4	59217111	missense	possibly damaging	0.95
R7362:Ugcg	UTSW	4	59217109	missense	probably damaging	1.00
R7472:Ugcg	UTSW	4	59217156	missense	probably benign
R7638:Ugcg	UTSW	4	59220299	missense	probably benign	0.26
R7866:Ugcg	UTSW	4	59211927	missense	possibly damaging	0.71
R8170:Ugcg	UTSW	4	59211974	missense	possibly damaging	0.71
R8488:Ugcg	UTSW	4	59213896	missense	probably benign	0.00
Y4336:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
Y4337:Ugcg	UTSW	4	59207798	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- TCTTGCTCCTGGTTCTTGTGTTT -3'
(R):5'- AGGCTAGGCTGTTTTCACAATCA -3'

Sequencing Primer
(F):5'- TCTAACCCAACTCTGTTCAG -3'
(R):5'- CACGTATTCTTTCATTCCCC -3'

Posted On

2015-04-17