Incidental Mutation 'R3917:Zbed5'
ID307333
Institutional Source Beutler Lab
Gene Symbol Zbed5
Ensembl Gene ENSMUSG00000034173
Gene Namezinc finger, BED type containing 5
Synonyms2410018M08Rik
MMRRC Submission 040914-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3917 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location129895723-129903623 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129902277 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 356 (Y356H)
Ref Sequence ENSEMBL: ENSMUSP00000044533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041466] [ENSMUST00000077320] [ENSMUST00000140667]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041466
AA Change: Y356H

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000044533
Gene: ENSMUSG00000034173
AA Change: Y356H

DomainStartEndE-ValueType
low complexity region 16 51 N/A INTRINSIC
low complexity region 60 75 N/A INTRINSIC
Pfam:DUF4371 281 412 1.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000077320
SMART Domains Protein: ENSMUSP00000116455
Gene: ENSMUSG00000034173

DomainStartEndE-ValueType
low complexity region 2 30 N/A INTRINSIC
low complexity region 39 54 N/A INTRINSIC
Pfam:CHCH 95 128 2.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140667
SMART Domains Protein: ENSMUSP00000117510
Gene: ENSMUSG00000025537

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 20 143 4.1e-9 PFAM
Pfam:Pkinase 20 144 3.2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202430
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is unusual in that its coding sequence is mostly derived from Charlie-like DNA transposon; however, it does not appear to be an active DNA transposon as it is not flanked by terminal inverted repeats. The encoded protein is conserved among the mammalian Laurasiatheria branch. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad12 A G 5: 121,599,214 V498A probably damaging Het
Adam19 A G 11: 46,060,935 E37G probably benign Het
Apol11b A G 15: 77,635,304 I192T probably benign Het
Appl1 A T 14: 26,928,604 F537Y probably damaging Het
Atad5 A C 11: 80,103,294 K785N probably null Het
Atp1b2 A G 11: 69,603,075 V93A probably damaging Het
Bcam T C 7: 19,765,450 Y216C probably damaging Het
Brca2 A G 5: 150,540,827 E1352G probably damaging Het
C030005K15Rik A C 10: 97,725,591 S93A unknown Het
Cadps C T 14: 12,457,702 A1060T probably benign Het
Ccdc88c A G 12: 100,941,107 probably null Het
Ccdc89 A G 7: 90,426,825 D81G probably damaging Het
Ccnt1 A G 15: 98,544,059 S443P probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdc42bpa T C 1: 180,106,154 probably null Het
Cdk11b T C 4: 155,626,801 S47P probably damaging Het
Cfap43 T C 19: 47,897,750 D142G probably benign Het
Cntnap4 C G 8: 112,875,533 P1190A probably benign Het
Colgalt2 T A 1: 152,508,611 Y567* probably null Het
Dner CGCTGCTGCTGCTGCTGCTGCTGCTGC CGCTGCTGCTGCTGCTGCTGCTGC 1: 84,585,549 probably benign Het
Dock7 T C 4: 99,016,685 Y651C probably damaging Het
Fzd3 A T 14: 65,235,930 F130I probably damaging Het
Gabarapl2 T A 8: 111,952,396 F115L probably benign Het
Gm1043 G A 5: 37,192,941 probably benign Het
Gm12185 A G 11: 48,915,933 F144L probably benign Het
Gm14124 T A 2: 150,266,119 probably benign Het
Gm21961 A T 15: 65,014,884 D7E unknown Het
Gtf3a A G 5: 146,955,434 K332E probably benign Het
Haao A G 17: 83,838,799 probably null Het
Habp2 T A 19: 56,311,179 C170S probably damaging Het
Heatr3 T G 8: 88,150,371 probably null Het
Herc1 T G 9: 66,434,466 C1846G possibly damaging Het
Hivep3 T C 4: 120,099,427 S1647P probably benign Het
Hnrnpul1 C T 7: 25,726,875 R517Q probably damaging Het
Hspg2 A G 4: 137,559,314 E3648G probably damaging Het
Jaml T C 9: 45,101,151 probably benign Het
Jund C T 8: 70,699,023 probably benign Het
Klra14-ps T C 6: 130,157,632 noncoding transcript Het
Krt88 G A 15: 101,452,928 probably null Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Lyzl4 T A 9: 121,583,035 D105V probably damaging Het
Mst1 A G 9: 108,084,295 I575V probably benign Het
Myd88 T C 9: 119,341,398 probably benign Het
Myo1d A T 11: 80,666,578 V512E probably damaging Het
Ndufv1 A G 19: 4,010,002 Y33H probably damaging Het
Nwd1 T A 8: 72,667,811 C608* probably null Het
Olfr118 T A 17: 37,672,793 F257I probably damaging Het
Olfr884 A T 9: 38,047,545 I108F probably damaging Het
Patj A T 4: 98,592,008 K1317* probably null Het
Pld5 A G 1: 175,963,938 S501P probably benign Het
Pnpo A G 11: 96,939,757 V146A probably damaging Het
Ppdpf A G 2: 181,187,728 Y16C probably benign Het
Ppp1r27 A G 11: 120,550,959 V32A possibly damaging Het
Rbm28 T C 6: 29,154,789 D294G probably benign Het
Sdk1 T A 5: 142,051,244 D817E probably damaging Het
Shank3 A G 15: 89,503,384 D252G possibly damaging Het
Slc29a1 A T 17: 45,588,973 probably null Het
Slc35a5 G C 16: 45,158,158 probably benign Het
Slc6a5 T C 7: 49,911,869 S50P probably damaging Het
Slfn8 A T 11: 83,016,993 Y241* probably null Het
Slu7 G T 11: 43,440,684 probably null Het
Smad2 T A 18: 76,287,937 D82E probably benign Het
Spx A C 6: 142,414,031 E33A probably damaging Het
Tdp1 A G 12: 99,894,717 Y205C probably damaging Het
Tekt1 A G 11: 72,345,748 I296T possibly damaging Het
Tgm1 G A 14: 55,712,757 probably benign Het
Tnks A G 8: 34,853,361 S719P probably damaging Het
Trip6 A G 5: 137,313,679 C47R probably benign Het
Trpv3 A G 11: 73,283,734 D309G possibly damaging Het
Tti2 A G 8: 31,153,519 K221E possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn1r57 A T 7: 5,220,631 N52Y probably damaging Het
Vmn2r94 A G 17: 18,244,358 F557L probably benign Het
Zic4 C A 9: 91,384,341 probably benign Het
Other mutations in Zbed5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02225:Zbed5 APN 5 129902133 unclassified probably null
IGL03334:Zbed5 APN 5 129902355 missense possibly damaging 0.66
R0449:Zbed5 UTSW 5 129901726 missense probably damaging 1.00
R0744:Zbed5 UTSW 5 129902272 missense possibly damaging 0.92
R0763:Zbed5 UTSW 5 129902179 missense probably benign 0.00
R1967:Zbed5 UTSW 5 129901669 missense possibly damaging 0.68
R2246:Zbed5 UTSW 5 129902751 missense probably benign 0.01
R2925:Zbed5 UTSW 5 129903198 missense possibly damaging 0.66
R3053:Zbed5 UTSW 5 129902146 missense possibly damaging 0.66
R3701:Zbed5 UTSW 5 129903159 missense possibly damaging 0.90
R3702:Zbed5 UTSW 5 129903159 missense possibly damaging 0.90
R3916:Zbed5 UTSW 5 129902277 missense possibly damaging 0.92
R4547:Zbed5 UTSW 5 129902851 nonsense probably null
R4548:Zbed5 UTSW 5 129902851 nonsense probably null
R5195:Zbed5 UTSW 5 129902178 missense probably benign 0.01
R5500:Zbed5 UTSW 5 129901982 nonsense probably null
R5813:Zbed5 UTSW 5 129902218 missense possibly damaging 0.46
R6377:Zbed5 UTSW 5 129903369 missense possibly damaging 0.83
R6620:Zbed5 UTSW 5 129903289 missense possibly damaging 0.82
R6862:Zbed5 UTSW 5 129903185 missense probably benign
R6931:Zbed5 UTSW 5 129903329 nonsense probably null
R7223:Zbed5 UTSW 5 129900438 missense probably damaging 1.00
R7831:Zbed5 UTSW 5 129901957 missense possibly damaging 0.82
R7914:Zbed5 UTSW 5 129901957 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TCGCCGGCAAGGATACCA -3'
(R):5'- GCTGAAACCCAGATTGACAGC -3'

Sequencing Primer
(F):5'- TGATACTGGCAGCAAGTCC -3'
(R):5'- ATTGACAGCCCAGCGTAG -3'
Posted On2015-04-17