Incidental Mutation 'R3917:Bcam'
ID307343
Institutional Source Beutler Lab
Gene Symbol Bcam
Ensembl Gene ENSMUSG00000002980
Gene Namebasal cell adhesion molecule
Synonyms1200005K12Rik, Lu, B-CAM
MMRRC Submission 040914-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3917 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location19756131-19771016 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19765450 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 216 (Y216C)
Ref Sequence ENSEMBL: ENSMUSP00000003061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003061] [ENSMUST00000133427] [ENSMUST00000155244]
Predicted Effect probably damaging
Transcript: ENSMUST00000003061
AA Change: Y216C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003061
Gene: ENSMUSG00000002980
AA Change: Y216C

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 32 137 3.1e-9 SMART
IG_like 174 254 1.89e1 SMART
IGc2 275 337 2.58e-6 SMART
IGc2 369 425 2.16e-8 SMART
IG_like 458 523 7.29e-2 SMART
transmembrane domain 541 563 N/A INTRINSIC
low complexity region 601 619 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133271
Predicted Effect probably benign
Transcript: ENSMUST00000133427
Predicted Effect probably benign
Transcript: ENSMUST00000155244
SMART Domains Protein: ENSMUSP00000121145
Gene: ENSMUSG00000002980

DomainStartEndE-ValueType
IG 32 137 3.1e-9 SMART
Pfam:C2-set_2 143 193 4.3e-12 PFAM
Pfam:Ig_2 145 192 1e-2 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208280
Meta Mutation Damage Score 0.6278 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes Lutheran blood group glycoprotein, a member of the immunoglobulin superfamily and a receptor for the extracellular matrix protein, laminin. The protein contains five extracellular immunoglobulin domains, a single transmembrane domain, and a short C-terminal cytoplasmic tail. This protein may play a role in epithelial cell cancer and in vaso-occlusion of red blood cells in sickle cell disease. Polymorphisms in this gene define some of the antigens in the Lutheran system and also the Auberger system. Inactivating variants of this gene result in the recessive Lutheran null phenotype, Lu(a-b-), of the Lutheran blood group. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: A gene trap insertion into an intron of this gene results in no obvious phenotype. Mice homozygous for a null allele exhibit glomeruli abnormalities and increased thickness and disorganization of intestinal smooth muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad12 A G 5: 121,599,214 V498A probably damaging Het
Adam19 A G 11: 46,060,935 E37G probably benign Het
Apol11b A G 15: 77,635,304 I192T probably benign Het
Appl1 A T 14: 26,928,604 F537Y probably damaging Het
Atad5 A C 11: 80,103,294 K785N probably null Het
Atp1b2 A G 11: 69,603,075 V93A probably damaging Het
Brca2 A G 5: 150,540,827 E1352G probably damaging Het
C030005K15Rik A C 10: 97,725,591 S93A unknown Het
Cadps C T 14: 12,457,702 A1060T probably benign Het
Ccdc88c A G 12: 100,941,107 probably null Het
Ccdc89 A G 7: 90,426,825 D81G probably damaging Het
Ccnt1 A G 15: 98,544,059 S443P probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdc42bpa T C 1: 180,106,154 probably null Het
Cdk11b T C 4: 155,626,801 S47P probably damaging Het
Cfap43 T C 19: 47,897,750 D142G probably benign Het
Cntnap4 C G 8: 112,875,533 P1190A probably benign Het
Colgalt2 T A 1: 152,508,611 Y567* probably null Het
Dner CGCTGCTGCTGCTGCTGCTGCTGCTGC CGCTGCTGCTGCTGCTGCTGCTGC 1: 84,585,549 probably benign Het
Dock7 T C 4: 99,016,685 Y651C probably damaging Het
Fzd3 A T 14: 65,235,930 F130I probably damaging Het
Gabarapl2 T A 8: 111,952,396 F115L probably benign Het
Gm1043 G A 5: 37,192,941 probably benign Het
Gm12185 A G 11: 48,915,933 F144L probably benign Het
Gm14124 T A 2: 150,266,119 probably benign Het
Gm21961 A T 15: 65,014,884 D7E unknown Het
Gtf3a A G 5: 146,955,434 K332E probably benign Het
Haao A G 17: 83,838,799 probably null Het
Habp2 T A 19: 56,311,179 C170S probably damaging Het
Heatr3 T G 8: 88,150,371 probably null Het
Herc1 T G 9: 66,434,466 C1846G possibly damaging Het
Hivep3 T C 4: 120,099,427 S1647P probably benign Het
Hnrnpul1 C T 7: 25,726,875 R517Q probably damaging Het
Hspg2 A G 4: 137,559,314 E3648G probably damaging Het
Jaml T C 9: 45,101,151 probably benign Het
Jund C T 8: 70,699,023 probably benign Het
Klra14-ps T C 6: 130,157,632 noncoding transcript Het
Krt88 G A 15: 101,452,928 probably null Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Lyzl4 T A 9: 121,583,035 D105V probably damaging Het
Mst1 A G 9: 108,084,295 I575V probably benign Het
Myd88 T C 9: 119,341,398 probably benign Het
Myo1d A T 11: 80,666,578 V512E probably damaging Het
Ndufv1 A G 19: 4,010,002 Y33H probably damaging Het
Nwd1 T A 8: 72,667,811 C608* probably null Het
Olfr118 T A 17: 37,672,793 F257I probably damaging Het
Olfr884 A T 9: 38,047,545 I108F probably damaging Het
Patj A T 4: 98,592,008 K1317* probably null Het
Pld5 A G 1: 175,963,938 S501P probably benign Het
Pnpo A G 11: 96,939,757 V146A probably damaging Het
Ppdpf A G 2: 181,187,728 Y16C probably benign Het
Ppp1r27 A G 11: 120,550,959 V32A possibly damaging Het
Rbm28 T C 6: 29,154,789 D294G probably benign Het
Sdk1 T A 5: 142,051,244 D817E probably damaging Het
Shank3 A G 15: 89,503,384 D252G possibly damaging Het
Slc29a1 A T 17: 45,588,973 probably null Het
Slc35a5 G C 16: 45,158,158 probably benign Het
Slc6a5 T C 7: 49,911,869 S50P probably damaging Het
Slfn8 A T 11: 83,016,993 Y241* probably null Het
Slu7 G T 11: 43,440,684 probably null Het
Smad2 T A 18: 76,287,937 D82E probably benign Het
Spx A C 6: 142,414,031 E33A probably damaging Het
Tdp1 A G 12: 99,894,717 Y205C probably damaging Het
Tekt1 A G 11: 72,345,748 I296T possibly damaging Het
Tgm1 G A 14: 55,712,757 probably benign Het
Tnks A G 8: 34,853,361 S719P probably damaging Het
Trip6 A G 5: 137,313,679 C47R probably benign Het
Trpv3 A G 11: 73,283,734 D309G possibly damaging Het
Tti2 A G 8: 31,153,519 K221E possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn1r57 A T 7: 5,220,631 N52Y probably damaging Het
Vmn2r94 A G 17: 18,244,358 F557L probably benign Het
Zbed5 T C 5: 129,902,277 Y356H possibly damaging Het
Zic4 C A 9: 91,384,341 probably benign Het
Other mutations in Bcam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Bcam APN 7 19756799 missense probably benign 0.02
IGL01433:Bcam APN 7 19760182 missense possibly damaging 0.75
IGL01712:Bcam APN 7 19758767 missense probably damaging 0.99
IGL01943:Bcam APN 7 19765498 missense probably damaging 1.00
IGL01946:Bcam APN 7 19760117 nonsense probably null
IGL02281:Bcam APN 7 19758691 missense probably damaging 1.00
IGL02714:Bcam APN 7 19758807 splice site probably benign
IGL02837:Bcam UTSW 7 19764186 missense probably damaging 1.00
PIT4514001:Bcam UTSW 7 19764066 missense probably benign 0.06
R0063:Bcam UTSW 7 19766848 missense probably benign 0.21
R0063:Bcam UTSW 7 19766848 missense probably benign 0.21
R1500:Bcam UTSW 7 19758964 missense possibly damaging 0.75
R1575:Bcam UTSW 7 19760382 missense possibly damaging 0.87
R1585:Bcam UTSW 7 19760186 missense probably damaging 1.00
R1768:Bcam UTSW 7 19765618 missense probably null 1.00
R1813:Bcam UTSW 7 19766715 missense probably damaging 1.00
R1896:Bcam UTSW 7 19766715 missense probably damaging 1.00
R2016:Bcam UTSW 7 19760349 missense probably benign 0.38
R2117:Bcam UTSW 7 19758427 missense possibly damaging 0.71
R3713:Bcam UTSW 7 19764193 missense probably benign 0.12
R4596:Bcam UTSW 7 19764157 missense probably damaging 0.97
R4866:Bcam UTSW 7 19765472 missense probably benign 0.00
R4874:Bcam UTSW 7 19769322 intron probably benign
R5054:Bcam UTSW 7 19756860 intron probably benign
R5062:Bcam UTSW 7 19760101 missense possibly damaging 0.62
R6783:Bcam UTSW 7 19766881 missense probably damaging 1.00
R6853:Bcam UTSW 7 19760406 missense probably damaging 1.00
R7016:Bcam UTSW 7 19758443 nonsense probably null
R7174:Bcam UTSW 7 19765451 missense probably damaging 1.00
R7237:Bcam UTSW 7 19769307 intron probably null
R7733:Bcam UTSW 7 19760388 missense probably benign 0.00
Z1177:Bcam UTSW 7 19760107 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GTAGAGTAAGGACCCCGATTGG -3'
(R):5'- TGGAAGTACCCATGGAGGTG -3'

Sequencing Primer
(F):5'- AATCGTGGTCTGGGAGTTCG -3'
(R):5'- TGAACCAAAGTGAGCCATCG -3'
Posted On2015-04-17