Mutagenetix > Incidental Mutations

Incidental Mutation 'R3917:Cntnap4'

307352

Institutional Source

Beutler Lab

Gene Symbol

Cntnap4

Ensembl Gene

ENSMUSG00000031772

Gene Name

contactin associated protein-like 4

Synonyms

E130114F09Rik, Caspr4

MMRRC Submission

040914-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.109) question?

Stock #

R3917 (G1)

Quality Score

165

Status

Validated

Chromosome

Chromosomal Location

112570043-112882717 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 112875533 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Alanine at position 1190 (P1190A)

Ref Sequence

ENSEMBL: ENSMUSP00000112511 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034225] [ENSMUST00000118171]

Predicted Effect

probably benign
Transcript: ENSMUST00000034225
AA Change: P1190A

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000034225
Gene: ENSMUSG00000031772
AA Change: P1190A

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FA58C	32	179	2.35e-19	SMART
LamG	206	343	5.14e-25	SMART
LamG	392	526	1.04e-25	SMART
EGF	554	588	1.4e0	SMART
Blast:FBG	591	775	1e-120	BLAST
LamG	815	942	1.01e-32	SMART
EGF	963	999	1.36e1	SMART
LamG	1040	1178	7.8e-16	SMART
transmembrane domain	1244	1266	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000118171
AA Change: P1190A

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000112511
Gene: ENSMUSG00000031772
AA Change: P1190A

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FA58C	32	179	2.35e-19	SMART
LamG	206	343	5.14e-25	SMART
LamG	392	526	1.04e-25	SMART
EGF	554	588	1.4e0	SMART
Blast:FBG	591	775	1e-120	BLAST
LamG	815	942	1.01e-32	SMART
EGF	963	999	1.36e1	SMART
LamG	1040	1178	2.06e-15	SMART
transmembrane domain	1244	1266	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213082

Meta Mutation Damage Score

0.0911

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.0%

Validation Efficiency

97% (74/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin protein family. Members of this family function in the vertebrate nervous system as cell adhesion molecules and receptors. This protein contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, and thrombospondin N-terminal-like domains. This protein may also play a role in proper neurotransmission in the dopaminergic and GABAergic systems and mutations in this gene may be associated with certain psychiatric illnesses. A polymorphism in an intron of this gene may be associated with longevity. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous knock-out mice show increased midbrain dopaminergic release in the nucleus accumbens, synaptic defects, impaired sensory-motor gating, and increased grooming behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acad12	A	G	5: 121,599,214	V498A	probably damaging	Het
Adam19	A	G	11: 46,060,935	E37G	probably benign	Het
Apol11b	A	G	15: 77,635,304	I192T	probably benign	Het
Appl1	A	T	14: 26,928,604	F537Y	probably damaging	Het
Atad5	A	C	11: 80,103,294	K785N	probably null	Het
Atp1b2	A	G	11: 69,603,075	V93A	probably damaging	Het
Bcam	T	C	7: 19,765,450	Y216C	probably damaging	Het
Brca2	A	G	5: 150,540,827	E1352G	probably damaging	Het
C030005K15Rik	A	C	10: 97,725,591	S93A	unknown	Het
Cadps	C	T	14: 12,457,702	A1060T	probably benign	Het
Ccdc88c	A	G	12: 100,941,107		probably null	Het
Ccdc89	A	G	7: 90,426,825	D81G	probably damaging	Het
Ccnt1	A	G	15: 98,544,059	S443P	probably benign	Het
Cd109	CATTTATTTATTTATTTATTTATTTATTTATTTAT	CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT	9: 78,712,500		probably benign	Het
Cdc42bpa	T	C	1: 180,106,154		probably null	Het
Cdk11b	T	C	4: 155,626,801	S47P	probably damaging	Het
Cfap43	T	C	19: 47,897,750	D142G	probably benign	Het
Colgalt2	T	A	1: 152,508,611	Y567*	probably null	Het
Dner	CGCTGCTGCTGCTGCTGCTGCTGCTGC	CGCTGCTGCTGCTGCTGCTGCTGC	1: 84,585,549		probably benign	Het
Dock7	T	C	4: 99,016,685	Y651C	probably damaging	Het
Fzd3	A	T	14: 65,235,930	F130I	probably damaging	Het
Gabarapl2	T	A	8: 111,952,396	F115L	probably benign	Het
Gm1043	G	A	5: 37,192,941		probably benign	Het
Gm12185	A	G	11: 48,915,933	F144L	probably benign	Het
Gm14124	T	A	2: 150,266,119		probably benign	Het
Gm21961	A	T	15: 65,014,884	D7E	unknown	Het
Gtf3a	A	G	5: 146,955,434	K332E	probably benign	Het
Haao	A	G	17: 83,838,799		probably null	Het
Habp2	T	A	19: 56,311,179	C170S	probably damaging	Het
Heatr3	T	G	8: 88,150,371		probably null	Het
Herc1	T	G	9: 66,434,466	C1846G	possibly damaging	Het
Hivep3	T	C	4: 120,099,427	S1647P	probably benign	Het
Hnrnpul1	C	T	7: 25,726,875	R517Q	probably damaging	Het
Hspg2	A	G	4: 137,559,314	E3648G	probably damaging	Het
Jaml	T	C	9: 45,101,151		probably benign	Het
Jund	C	T	8: 70,699,023		probably benign	Het
Klra14-ps	T	C	6: 130,157,632		noncoding transcript	Het
Krt88	G	A	15: 101,452,928		probably null	Het
Lrp5	G	A	19: 3,612,330	R173C	probably damaging	Het
Lyzl4	T	A	9: 121,583,035	D105V	probably damaging	Het
Mst1	A	G	9: 108,084,295	I575V	probably benign	Het
Myd88	T	C	9: 119,341,398		probably benign	Het
Myo1d	A	T	11: 80,666,578	V512E	probably damaging	Het
Ndufv1	A	G	19: 4,010,002	Y33H	probably damaging	Het
Nwd1	T	A	8: 72,667,811	C608*	probably null	Het
Olfr118	T	A	17: 37,672,793	F257I	probably damaging	Het
Olfr884	A	T	9: 38,047,545	I108F	probably damaging	Het
Patj	A	T	4: 98,592,008	K1317*	probably null	Het
Pld5	A	G	1: 175,963,938	S501P	probably benign	Het
Pnpo	A	G	11: 96,939,757	V146A	probably damaging	Het
Ppdpf	A	G	2: 181,187,728	Y16C	probably benign	Het
Ppp1r27	A	G	11: 120,550,959	V32A	possibly damaging	Het
Rbm28	T	C	6: 29,154,789	D294G	probably benign	Het
Sdk1	T	A	5: 142,051,244	D817E	probably damaging	Het
Shank3	A	G	15: 89,503,384	D252G	possibly damaging	Het
Slc29a1	A	T	17: 45,588,973		probably null	Het
Slc35a5	G	C	16: 45,158,158		probably benign	Het
Slc6a5	T	C	7: 49,911,869	S50P	probably damaging	Het
Slfn8	A	T	11: 83,016,993	Y241*	probably null	Het
Slu7	G	T	11: 43,440,684		probably null	Het
Smad2	T	A	18: 76,287,937	D82E	probably benign	Het
Spx	A	C	6: 142,414,031	E33A	probably damaging	Het
Tdp1	A	G	12: 99,894,717	Y205C	probably damaging	Het
Tekt1	A	G	11: 72,345,748	I296T	possibly damaging	Het
Tgm1	G	A	14: 55,712,757		probably benign	Het
Tnks	A	G	8: 34,853,361	S719P	probably damaging	Het
Trip6	A	G	5: 137,313,679	C47R	probably benign	Het
Trpv3	A	G	11: 73,283,734	D309G	possibly damaging	Het
Tti2	A	G	8: 31,153,519	K221E	possibly damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Vmn1r57	A	T	7: 5,220,631	N52Y	probably damaging	Het
Vmn2r94	A	G	17: 18,244,358	F557L	probably benign	Het
Zbed5	T	C	5: 129,902,277	Y356H	possibly damaging	Het
Zic4	C	A	9: 91,384,341		probably benign	Het

Other mutations in Cntnap4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00847:Cntnap4	APN	8	112767619	splice site	probably benign
IGL01898:Cntnap4	APN	8	112856307	missense	possibly damaging	0.46
IGL01918:Cntnap4	APN	8	112752234	missense	possibly damaging	0.67
IGL02257:Cntnap4	APN	8	112616494	missense	probably damaging	1.00
IGL02302:Cntnap4	APN	8	112785903	splice site	probably benign
IGL02621:Cntnap4	APN	8	112810723	missense	probably damaging	1.00
IGL03008:Cntnap4	APN	8	112773590	missense	probably benign	0.06
IGL03327:Cntnap4	APN	8	112773576	missense	probably benign	0.00
IGL03346:Cntnap4	APN	8	112773576	missense	probably benign	0.00
R0025:Cntnap4	UTSW	8	112803164	missense	probably damaging	1.00
R0025:Cntnap4	UTSW	8	112803164	missense	probably damaging	1.00
R0058:Cntnap4	UTSW	8	112785784	missense	probably damaging	0.98
R0310:Cntnap4	UTSW	8	112842516	critical splice acceptor site	probably null
R0363:Cntnap4	UTSW	8	112856511	nonsense	probably null
R0497:Cntnap4	UTSW	8	112570151	missense	probably benign	0.00
R1495:Cntnap4	UTSW	8	112881763	missense	possibly damaging	0.81
R1579:Cntnap4	UTSW	8	112881830	missense	possibly damaging	0.89
R1704:Cntnap4	UTSW	8	112757523	missense	probably damaging	1.00
R1943:Cntnap4	UTSW	8	112815496	missense	probably benign	0.10
R2160:Cntnap4	UTSW	8	112757571	missense	probably damaging	1.00
R2226:Cntnap4	UTSW	8	112815488	missense	probably damaging	0.98
R3148:Cntnap4	UTSW	8	112757439	missense	probably damaging	1.00
R3916:Cntnap4	UTSW	8	112875533	missense	probably benign	0.02
R4097:Cntnap4	UTSW	8	112752307	missense	probably benign	0.03
R4348:Cntnap4	UTSW	8	112753922	missense	probably damaging	1.00
R4469:Cntnap4	UTSW	8	112665266	missense	probably damaging	1.00
R4530:Cntnap4	UTSW	8	112858210	missense	probably benign	0.32
R4531:Cntnap4	UTSW	8	112810608	missense	possibly damaging	0.90
R4586:Cntnap4	UTSW	8	112810710	missense	probably benign
R4611:Cntnap4	UTSW	8	112773739	critical splice donor site	probably null
R4675:Cntnap4	UTSW	8	112785836	missense	probably damaging	1.00
R4801:Cntnap4	UTSW	8	112773590	missense	possibly damaging	0.94
R4802:Cntnap4	UTSW	8	112773590	missense	possibly damaging	0.94
R5273:Cntnap4	UTSW	8	112733438	missense	probably damaging	1.00
R6114:Cntnap4	UTSW	8	112841753	missense	probably damaging	1.00
R6194:Cntnap4	UTSW	8	112875429	missense	probably damaging	1.00
R6222:Cntnap4	UTSW	8	112842721	missense	probably damaging	1.00
R6262:Cntnap4	UTSW	8	112803211	missense	probably damaging	0.99
R6276:Cntnap4	UTSW	8	112752289	missense	possibly damaging	0.94
R6483:Cntnap4	UTSW	8	112757473	missense	possibly damaging	0.82
R6819:Cntnap4	UTSW	8	112803226	missense	probably benign	0.03
R7031:Cntnap4	UTSW	8	112858242	missense	probably benign	0.01
R7107:Cntnap4	UTSW	8	112815488	missense	probably damaging	0.98
R7146:Cntnap4	UTSW	8	112810636	missense	probably damaging	1.00
R7192:Cntnap4	UTSW	8	112881800	missense	probably benign	0.05
R7232:Cntnap4	UTSW	8	112665099	splice site	probably null
R7348:Cntnap4	UTSW	8	112665277	missense	probably damaging	1.00
R7482:Cntnap4	UTSW	8	112733562	critical splice donor site	probably null
R7832:Cntnap4	UTSW	8	112757481	missense	probably benign
R7895:Cntnap4	UTSW	8	112752197	missense	probably damaging	0.99
R8014:Cntnap4	UTSW	8	112753945	missense	probably damaging	0.99
R8185:Cntnap4	UTSW	8	112665265	missense	probably damaging	1.00
R8197:Cntnap4	UTSW	8	112570225	missense	probably benign	0.00
R8287:Cntnap4	UTSW	8	112859143	missense	probably damaging	1.00
R8299:Cntnap4	UTSW	8	112773692	missense	probably damaging	1.00
R8498:Cntnap4	UTSW	8	112875579	missense	possibly damaging	0.52
R8774:Cntnap4	UTSW	8	112803188	missense	probably benign	0.01
R8774-TAIL:Cntnap4	UTSW	8	112803188	missense	probably benign	0.01
X0025:Cntnap4	UTSW	8	112859143	missense	probably damaging	1.00
X0063:Cntnap4	UTSW	8	112875579	missense	probably benign	0.05
Z1088:Cntnap4	UTSW	8	112815520	missense	probably damaging	1.00
Z1176:Cntnap4	UTSW	8	112858189	missense	possibly damaging	0.70
Z1186:Cntnap4	UTSW	8	112752370	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGCAAGGTATCGGATGTCTGC -3'
(R):5'- TGTCAACTGCAAATGAGCATG -3'

Sequencing Primer
(F):5'- CATCAATGCCTTTCCTGTTGG -3'
(R):5'- GTCAACTGCAAATGAGCATGAAATC -3'

Posted On

2015-04-17