Incidental Mutation 'R3917:Zic4'
ID307357
Institutional Source Beutler Lab
Gene Symbol Zic4
Ensembl Gene ENSMUSG00000036972
Gene Namezinc finger protein of the cerebellum 4
Synonyms
MMRRC Submission 040914-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.246) question?
Stock #R3917 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location91362413-91389348 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 91384341 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066384] [ENSMUST00000172646] [ENSMUST00000173933]
Predicted Effect probably benign
Transcript: ENSMUST00000066384
SMART Domains Protein: ENSMUSP00000069568
Gene: ENSMUSG00000036972

DomainStartEndE-ValueType
ZnF_C2H2 135 169 4.74e1 SMART
ZnF_C2H2 178 205 7.68e0 SMART
ZnF_C2H2 211 235 8.02e-5 SMART
ZnF_C2H2 241 265 7.15e-2 SMART
ZnF_C2H2 271 295 3.21e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000085242
SMART Domains Protein: ENSMUSP00000082339
Gene: ENSMUSG00000036972

DomainStartEndE-ValueType
ZnF_C2H2 24 48 7.15e-2 SMART
ZnF_C2H2 54 78 3.21e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170572
Predicted Effect probably benign
Transcript: ENSMUST00000172646
SMART Domains Protein: ENSMUSP00000134053
Gene: ENSMUSG00000036972

DomainStartEndE-ValueType
ZnF_C2H2 128 162 4.74e1 SMART
ZnF_C2H2 171 198 7.68e0 SMART
ZnF_C2H2 204 228 8.02e-5 SMART
ZnF_C2H2 234 258 7.15e-2 SMART
ZnF_C2H2 264 288 3.21e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172858
SMART Domains Protein: ENSMUSP00000133795
Gene: ENSMUSG00000036972

DomainStartEndE-ValueType
ZnF_C2H2 135 169 4.74e1 SMART
ZnF_C2H2 178 205 7.68e0 SMART
ZnF_C2H2 211 235 8.02e-5 SMART
ZnF_C2H2 241 265 7.15e-2 SMART
ZnF_C2H2 271 295 3.21e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173933
SMART Domains Protein: ENSMUSP00000133958
Gene: ENSMUSG00000036972

DomainStartEndE-ValueType
ZnF_C2H2 128 162 4.74e1 SMART
ZnF_C2H2 171 198 7.68e0 SMART
ZnF_C2H2 204 228 8.02e-5 SMART
ZnF_C2H2 234 258 7.15e-2 SMART
ZnF_C2H2 264 288 3.21e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174611
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195215
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ZIC family of C2H2-type zinc finger proteins. Members of this family are important during development, and have been associated with X-linked visceral heterotaxy and holoprosencephaly type 5. This gene is closely linked to the gene encoding zinc finger protein of the cerebellum 1, a related family member on chromosome 3. Heterozygous deletion of these linked genes is involved in Dandy-Walker malformation, which is a congenital cerebellar malformation. Multiple transcript variants have been identified for this gene. [provided by RefSeq, Dec 2009]
PHENOTYPE: Mice heterozygous for a knock-out allele exhibit posterior cerebellar hypoplasia and a mild defect in anterior cerebellar foliation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad12 A G 5: 121,599,214 V498A probably damaging Het
Adam19 A G 11: 46,060,935 E37G probably benign Het
Apol11b A G 15: 77,635,304 I192T probably benign Het
Appl1 A T 14: 26,928,604 F537Y probably damaging Het
Atad5 A C 11: 80,103,294 K785N probably null Het
Atp1b2 A G 11: 69,603,075 V93A probably damaging Het
Bcam T C 7: 19,765,450 Y216C probably damaging Het
Brca2 A G 5: 150,540,827 E1352G probably damaging Het
C030005K15Rik A C 10: 97,725,591 S93A unknown Het
Cadps C T 14: 12,457,702 A1060T probably benign Het
Ccdc88c A G 12: 100,941,107 probably null Het
Ccdc89 A G 7: 90,426,825 D81G probably damaging Het
Ccnt1 A G 15: 98,544,059 S443P probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdc42bpa T C 1: 180,106,154 probably null Het
Cdk11b T C 4: 155,626,801 S47P probably damaging Het
Cfap43 T C 19: 47,897,750 D142G probably benign Het
Cntnap4 C G 8: 112,875,533 P1190A probably benign Het
Colgalt2 T A 1: 152,508,611 Y567* probably null Het
Dner CGCTGCTGCTGCTGCTGCTGCTGCTGC CGCTGCTGCTGCTGCTGCTGCTGC 1: 84,585,549 probably benign Het
Dock7 T C 4: 99,016,685 Y651C probably damaging Het
Fzd3 A T 14: 65,235,930 F130I probably damaging Het
Gabarapl2 T A 8: 111,952,396 F115L probably benign Het
Gm1043 G A 5: 37,192,941 probably benign Het
Gm12185 A G 11: 48,915,933 F144L probably benign Het
Gm14124 T A 2: 150,266,119 probably benign Het
Gm21961 A T 15: 65,014,884 D7E unknown Het
Gtf3a A G 5: 146,955,434 K332E probably benign Het
Haao A G 17: 83,838,799 probably null Het
Habp2 T A 19: 56,311,179 C170S probably damaging Het
Heatr3 T G 8: 88,150,371 probably null Het
Herc1 T G 9: 66,434,466 C1846G possibly damaging Het
Hivep3 T C 4: 120,099,427 S1647P probably benign Het
Hnrnpul1 C T 7: 25,726,875 R517Q probably damaging Het
Hspg2 A G 4: 137,559,314 E3648G probably damaging Het
Jaml T C 9: 45,101,151 probably benign Het
Jund C T 8: 70,699,023 probably benign Het
Klra14-ps T C 6: 130,157,632 noncoding transcript Het
Krt88 G A 15: 101,452,928 probably null Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Lyzl4 T A 9: 121,583,035 D105V probably damaging Het
Mst1 A G 9: 108,084,295 I575V probably benign Het
Myd88 T C 9: 119,341,398 probably benign Het
Myo1d A T 11: 80,666,578 V512E probably damaging Het
Ndufv1 A G 19: 4,010,002 Y33H probably damaging Het
Nwd1 T A 8: 72,667,811 C608* probably null Het
Olfr118 T A 17: 37,672,793 F257I probably damaging Het
Olfr884 A T 9: 38,047,545 I108F probably damaging Het
Patj A T 4: 98,592,008 K1317* probably null Het
Pld5 A G 1: 175,963,938 S501P probably benign Het
Pnpo A G 11: 96,939,757 V146A probably damaging Het
Ppdpf A G 2: 181,187,728 Y16C probably benign Het
Ppp1r27 A G 11: 120,550,959 V32A possibly damaging Het
Rbm28 T C 6: 29,154,789 D294G probably benign Het
Sdk1 T A 5: 142,051,244 D817E probably damaging Het
Shank3 A G 15: 89,503,384 D252G possibly damaging Het
Slc29a1 A T 17: 45,588,973 probably null Het
Slc35a5 G C 16: 45,158,158 probably benign Het
Slc6a5 T C 7: 49,911,869 S50P probably damaging Het
Slfn8 A T 11: 83,016,993 Y241* probably null Het
Slu7 G T 11: 43,440,684 probably null Het
Smad2 T A 18: 76,287,937 D82E probably benign Het
Spx A C 6: 142,414,031 E33A probably damaging Het
Tdp1 A G 12: 99,894,717 Y205C probably damaging Het
Tekt1 A G 11: 72,345,748 I296T possibly damaging Het
Tgm1 G A 14: 55,712,757 probably benign Het
Tnks A G 8: 34,853,361 S719P probably damaging Het
Trip6 A G 5: 137,313,679 C47R probably benign Het
Trpv3 A G 11: 73,283,734 D309G possibly damaging Het
Tti2 A G 8: 31,153,519 K221E possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn1r57 A T 7: 5,220,631 N52Y probably damaging Het
Vmn2r94 A G 17: 18,244,358 F557L probably benign Het
Zbed5 T C 5: 129,902,277 Y356H possibly damaging Het
Other mutations in Zic4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02423:Zic4 APN 9 91384175 missense probably damaging 1.00
PIT4418001:Zic4 UTSW 9 91379394 missense possibly damaging 0.91
R0628:Zic4 UTSW 9 91384117 nonsense probably null
R0628:Zic4 UTSW 9 91384119 missense probably benign 0.09
R1747:Zic4 UTSW 9 91384146 missense probably damaging 1.00
R2242:Zic4 UTSW 9 91378653 intron probably benign
R4021:Zic4 UTSW 9 91379036 missense probably benign 0.00
R4457:Zic4 UTSW 9 91379262 missense probably damaging 0.97
R4722:Zic4 UTSW 9 91379204 missense probably damaging 1.00
R5135:Zic4 UTSW 9 91384152 missense probably damaging 1.00
R5441:Zic4 UTSW 9 91384200 missense probably damaging 1.00
R5629:Zic4 UTSW 9 91378752 missense probably benign 0.36
R7179:Zic4 UTSW 9 91379121 missense possibly damaging 0.89
R7238:Zic4 UTSW 9 91379397 missense probably benign 0.38
R7801:Zic4 UTSW 9 91384244 missense probably benign 0.03
X0018:Zic4 UTSW 9 91378803 missense probably damaging 1.00
Z1177:Zic4 UTSW 9 91378856 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCTTATATGTGCAAGGTGC -3'
(R):5'- ACTTCTTGAAGCCTCAGTGG -3'

Sequencing Primer
(F):5'- TGTGACAAGTGTTACACGCAC -3'
(R):5'- TAAACCAGAGCAGCTCG -3'
Posted On2015-04-17