Incidental Mutation 'R0376:Plppr4'
ID30737
Institutional Source Beutler Lab
Gene Symbol Plppr4
Ensembl Gene ENSMUSG00000044667
Gene Namephospholipid phosphatase related 4
SynonymsLppr4, D3Bwg0562e
MMRRC Submission 038582-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0376 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location117319139-117360876 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 117323091 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 314 (H314Q)
Ref Sequence ENSEMBL: ENSMUSP00000143753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061071] [ENSMUST00000197743]
Predicted Effect probably benign
Transcript: ENSMUST00000061071
AA Change: H372Q

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000052306
Gene: ENSMUSG00000044667
AA Change: H372Q

DomainStartEndE-ValueType
acidPPc 180 324 4.07e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125664
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174925
Predicted Effect probably benign
Transcript: ENSMUST00000197743
AA Change: H314Q

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000143753
Gene: ENSMUSG00000044667
AA Change: H314Q

DomainStartEndE-ValueType
SCOP:d1d2ta_ 59 268 1e-7 SMART
Blast:acidPPc 180 265 8e-53 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.0%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the lipid phosphate phosphatase (LPP) family. LPPs catalyze the dephosphorylation of a number of bioactive lipid mediators that regulate a variety of cell functions. This protein is specifically expressed in neurons. It is located in the membranes of outgrowing axons and has been shown to be important for axonal outgrowth during development and regenerative sprouting. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced body weight, seizures, hyperexcitability of evoked fEPSP, and premature lethality around 3 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik G A 2: 173,528,327 E132K probably benign Het
Adam6a T C 12: 113,544,690 Y228H probably damaging Het
Als2 A G 1: 59,215,565 F211S probably benign Het
Ankrd12 T A 17: 66,053,009 Q11L probably damaging Het
Anxa5 T C 3: 36,460,488 R115G probably damaging Het
Arhgap10 T C 8: 77,450,824 probably benign Het
Atp2a3 T A 11: 72,982,702 D782E probably damaging Het
Bcr G T 10: 75,145,327 L659F probably damaging Het
Cacna1b A G 2: 24,659,003 probably benign Het
Camp C T 9: 109,848,399 C122Y probably damaging Het
Col12a1 A T 9: 79,693,494 S769R probably benign Het
Cyp2j6 T A 4: 96,526,023 K335I probably damaging Het
Cyp3a11 A C 5: 145,862,452 Y308* probably null Het
Flnb G A 14: 7,946,014 probably null Het
Frmd4a G T 2: 4,572,387 M351I probably damaging Het
Gabrg2 C T 11: 41,916,315 S365N possibly damaging Het
Ggn T C 7: 29,173,022 V609A possibly damaging Het
H60c T C 10: 3,260,435 probably benign Het
Hexdc T A 11: 121,218,165 probably benign Het
Igsf9b A G 9: 27,334,582 T1282A probably benign Het
Ikzf4 T C 10: 128,632,756 N618S probably benign Het
Ints14 A G 9: 64,983,990 K418E probably damaging Het
Iqgap1 T C 7: 80,723,879 E1454G probably benign Het
Kif13b T C 14: 64,757,404 probably benign Het
Krt71 A C 15: 101,738,070 F328C probably damaging Het
Lama2 T C 10: 27,015,546 T2524A possibly damaging Het
Mfn2 C T 4: 147,885,526 V363I probably benign Het
Mkln1 A T 6: 31,478,018 D496V probably benign Het
Olfr450 A T 6: 42,818,292 M274L probably benign Het
Patj T A 4: 98,568,987 I1242N probably damaging Het
Pcnx C T 12: 81,974,579 probably benign Het
Plcb2 T C 2: 118,717,240 E502G probably damaging Het
Prkcsh A G 9: 22,010,251 probably benign Het
Prr14 C T 7: 127,476,643 H181Y probably benign Het
Pus3 A T 9: 35,566,422 M317L possibly damaging Het
Pwwp2a T A 11: 43,704,672 D221E probably benign Het
Rbm15 T C 3: 107,330,938 S715G probably benign Het
Rbm28 A G 6: 29,158,928 probably benign Het
Rhobtb2 A T 14: 69,796,735 V347E probably benign Het
Rimbp2 C T 5: 128,803,861 R161Q probably damaging Het
Scgb1b27 C T 7: 34,021,897 T70I possibly damaging Het
Slc40a1 T C 1: 45,912,491 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spaca9 A G 2: 28,693,660 V104A probably benign Het
Spag7 T C 11: 70,669,190 probably benign Het
Sugp1 A G 8: 70,052,638 D85G probably damaging Het
Sun1 A G 5: 139,226,699 probably benign Het
Tcp11l1 C A 2: 104,697,505 probably benign Het
Tead3 A C 17: 28,341,365 D88E probably damaging Het
Tecpr1 A T 5: 144,207,476 V636E possibly damaging Het
Tldc2 T C 2: 157,095,305 W147R probably damaging Het
Tmem161b A G 13: 84,292,383 T125A probably benign Het
Trrap A G 5: 144,816,339 M1825V probably benign Het
Ttbk2 A G 2: 120,777,581 F186L probably damaging Het
U2surp C T 9: 95,484,443 V470I probably benign Het
Zc3h7a T C 16: 11,156,202 M240V probably benign Het
Zc3hc1 G C 6: 30,372,790 S351W probably damaging Het
Zfp366 T C 13: 99,234,251 M493T probably benign Het
Zfp93 C T 7: 24,275,861 P424S probably damaging Het
Other mutations in Plppr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Plppr4 APN 3 117322220 missense probably benign 0.01
IGL01969:Plppr4 APN 3 117328359 missense probably damaging 1.00
IGL02014:Plppr4 APN 3 117335573 missense probably damaging 1.00
IGL02068:Plppr4 APN 3 117331784 splice site probably benign
IGL02426:Plppr4 APN 3 117322295 missense probably benign 0.01
IGL03203:Plppr4 APN 3 117325891 missense possibly damaging 0.89
PIT4445001:Plppr4 UTSW 3 117360308 unclassified probably benign
R0755:Plppr4 UTSW 3 117322670 missense possibly damaging 0.68
R0831:Plppr4 UTSW 3 117331646 critical splice donor site probably null
R1518:Plppr4 UTSW 3 117335503 missense probably damaging 1.00
R1523:Plppr4 UTSW 3 117322841 missense probably damaging 1.00
R1581:Plppr4 UTSW 3 117328266 missense possibly damaging 0.58
R1628:Plppr4 UTSW 3 117328272 missense probably damaging 1.00
R2510:Plppr4 UTSW 3 117331706 missense probably damaging 0.99
R2511:Plppr4 UTSW 3 117331706 missense probably damaging 0.99
R4332:Plppr4 UTSW 3 117322825 missense probably benign
R4380:Plppr4 UTSW 3 117322397 missense probably benign 0.40
R4787:Plppr4 UTSW 3 117322330 missense probably damaging 0.99
R4829:Plppr4 UTSW 3 117335591 missense possibly damaging 0.94
R5511:Plppr4 UTSW 3 117325902 missense probably benign 0.39
R5819:Plppr4 UTSW 3 117325864 missense possibly damaging 0.89
R6149:Plppr4 UTSW 3 117322394 missense probably benign 0.22
R6257:Plppr4 UTSW 3 117322579 missense possibly damaging 0.49
R6974:Plppr4 UTSW 3 117323018 missense probably damaging 1.00
R7045:Plppr4 UTSW 3 117360034 missense probably damaging 1.00
R7102:Plppr4 UTSW 3 117323183 missense probably damaging 0.98
R7507:Plppr4 UTSW 3 117322105 missense possibly damaging 0.76
R7820:Plppr4 UTSW 3 117321949 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GGCATGGATGCTCGCATTTCTTC -3'
(R):5'- AGTGCCTACCTCAGTTGTGTGCTC -3'

Sequencing Primer
(F):5'- CTCACTGGGTCTTCCACGG -3'
(R):5'- AGAACCGTGATTGCTTGTTCC -3'
Posted On2013-04-24