Mutagenetix > Incidental Mutations

Incidental Mutation 'R3917:Appl1'

307377

Institutional Source

Beutler Lab

Gene Symbol

Appl1

Ensembl Gene

ENSMUSG00000040760

Gene Name

adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1

Synonyms

7330406P05Rik, 2900057D21Rik

MMRRC Submission

040914-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.172) question?

Stock #

R3917 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

26918988-26971232 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 26928604 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Tyrosine at position 537 (F537Y)

Ref Sequence

ENSEMBL: ENSMUSP00000042875 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036570]

Predicted Effect

probably damaging
Transcript: ENSMUST00000036570
AA Change: F537Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000042875
Gene: ENSMUSG00000040760
AA Change: F537Y

Domain	Start	End	E-Value	Type
Pfam:BAR_3	7	249	2.6e-66	PFAM
PH	278	377	1.4e-3	SMART
low complexity region	425	434	N/A	INTRINSIC
Pfam:PID	501	632	6.6e-12	PFAM
low complexity region	645	660	N/A	INTRINSIC
low complexity region	679	700	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223843

Meta Mutation Damage Score

0.3038

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.0%

Validation Efficiency

97% (74/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has been shown to be involved in the regulation of cell proliferation, and in the crosstalk between the adiponectin signalling and insulin signalling pathways. The encoded protein binds many other proteins, including RAB5A, DCC, AKT2, PIK3CA, adiponectin receptors, and proteins of the NuRD/MeCP1 complex. This protein is found associated with endosomal membranes, but can be released by EGF and translocated to the nucleus. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased insulin-induced relaxation and increased insulin-induced ET-1-dependent vasoconstriction when fed a high fat diet. Homozygotes for a second null allele show increased hematocrit and T cell proliferation, and decreased fibroblast cell migration. Homozygotes for a third null allele show hyperactivity, increased body core temperature, and insulin resistance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acad12	A	G	5: 121,599,214	V498A	probably damaging	Het
Adam19	A	G	11: 46,060,935	E37G	probably benign	Het
Apol11b	A	G	15: 77,635,304	I192T	probably benign	Het
Atad5	A	C	11: 80,103,294	K785N	probably null	Het
Atp1b2	A	G	11: 69,603,075	V93A	probably damaging	Het
Bcam	T	C	7: 19,765,450	Y216C	probably damaging	Het
Brca2	A	G	5: 150,540,827	E1352G	probably damaging	Het
C030005K15Rik	A	C	10: 97,725,591	S93A	unknown	Het
Cadps	C	T	14: 12,457,702	A1060T	probably benign	Het
Ccdc88c	A	G	12: 100,941,107		probably null	Het
Ccdc89	A	G	7: 90,426,825	D81G	probably damaging	Het
Ccnt1	A	G	15: 98,544,059	S443P	probably benign	Het
Cd109	CATTTATTTATTTATTTATTTATTTATTTATTTAT	CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT	9: 78,712,500		probably benign	Het
Cdc42bpa	T	C	1: 180,106,154		probably null	Het
Cdk11b	T	C	4: 155,626,801	S47P	probably damaging	Het
Cfap43	T	C	19: 47,897,750	D142G	probably benign	Het
Cntnap4	C	G	8: 112,875,533	P1190A	probably benign	Het
Colgalt2	T	A	1: 152,508,611	Y567*	probably null	Het
Dner	CGCTGCTGCTGCTGCTGCTGCTGCTGC	CGCTGCTGCTGCTGCTGCTGCTGC	1: 84,585,549		probably benign	Het
Dock7	T	C	4: 99,016,685	Y651C	probably damaging	Het
Fzd3	A	T	14: 65,235,930	F130I	probably damaging	Het
Gabarapl2	T	A	8: 111,952,396	F115L	probably benign	Het
Gm1043	G	A	5: 37,192,941		probably benign	Het
Gm12185	A	G	11: 48,915,933	F144L	probably benign	Het
Gm14124	T	A	2: 150,266,119		probably benign	Het
Gm21961	A	T	15: 65,014,884	D7E	unknown	Het
Gtf3a	A	G	5: 146,955,434	K332E	probably benign	Het
Haao	A	G	17: 83,838,799		probably null	Het
Habp2	T	A	19: 56,311,179	C170S	probably damaging	Het
Heatr3	T	G	8: 88,150,371		probably null	Het
Herc1	T	G	9: 66,434,466	C1846G	possibly damaging	Het
Hivep3	T	C	4: 120,099,427	S1647P	probably benign	Het
Hnrnpul1	C	T	7: 25,726,875	R517Q	probably damaging	Het
Hspg2	A	G	4: 137,559,314	E3648G	probably damaging	Het
Jaml	T	C	9: 45,101,151		probably benign	Het
Jund	C	T	8: 70,699,023		probably benign	Het
Klra14-ps	T	C	6: 130,157,632		noncoding transcript	Het
Krt88	G	A	15: 101,452,928		probably null	Het
Lrp5	G	A	19: 3,612,330	R173C	probably damaging	Het
Lyzl4	T	A	9: 121,583,035	D105V	probably damaging	Het
Mst1	A	G	9: 108,084,295	I575V	probably benign	Het
Myd88	T	C	9: 119,341,398		probably benign	Het
Myo1d	A	T	11: 80,666,578	V512E	probably damaging	Het
Ndufv1	A	G	19: 4,010,002	Y33H	probably damaging	Het
Nwd1	T	A	8: 72,667,811	C608*	probably null	Het
Olfr118	T	A	17: 37,672,793	F257I	probably damaging	Het
Olfr884	A	T	9: 38,047,545	I108F	probably damaging	Het
Patj	A	T	4: 98,592,008	K1317*	probably null	Het
Pld5	A	G	1: 175,963,938	S501P	probably benign	Het
Pnpo	A	G	11: 96,939,757	V146A	probably damaging	Het
Ppdpf	A	G	2: 181,187,728	Y16C	probably benign	Het
Ppp1r27	A	G	11: 120,550,959	V32A	possibly damaging	Het
Rbm28	T	C	6: 29,154,789	D294G	probably benign	Het
Sdk1	T	A	5: 142,051,244	D817E	probably damaging	Het
Shank3	A	G	15: 89,503,384	D252G	possibly damaging	Het
Slc29a1	A	T	17: 45,588,973		probably null	Het
Slc35a5	G	C	16: 45,158,158		probably benign	Het
Slc6a5	T	C	7: 49,911,869	S50P	probably damaging	Het
Slfn8	A	T	11: 83,016,993	Y241*	probably null	Het
Slu7	G	T	11: 43,440,684		probably null	Het
Smad2	T	A	18: 76,287,937	D82E	probably benign	Het
Spx	A	C	6: 142,414,031	E33A	probably damaging	Het
Tdp1	A	G	12: 99,894,717	Y205C	probably damaging	Het
Tekt1	A	G	11: 72,345,748	I296T	possibly damaging	Het
Tgm1	G	A	14: 55,712,757		probably benign	Het
Tnks	A	G	8: 34,853,361	S719P	probably damaging	Het
Trip6	A	G	5: 137,313,679	C47R	probably benign	Het
Trpv3	A	G	11: 73,283,734	D309G	possibly damaging	Het
Tti2	A	G	8: 31,153,519	K221E	possibly damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Vmn1r57	A	T	7: 5,220,631	N52Y	probably damaging	Het
Vmn2r94	A	G	17: 18,244,358	F557L	probably benign	Het
Zbed5	T	C	5: 129,902,277	Y356H	possibly damaging	Het
Zic4	C	A	9: 91,384,341		probably benign	Het

Other mutations in Appl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01013:Appl1	APN	14	26949476	missense	possibly damaging	0.89
IGL01615:Appl1	APN	14	26959470	splice site	probably benign
IGL01633:Appl1	APN	14	26962838	missense	probably damaging	0.99
IGL01945:Appl1	APN	14	26928655	missense	possibly damaging	0.80
IGL02210:Appl1	APN	14	26925952	splice site	probably benign
IGL02650:Appl1	APN	14	26950708	missense	possibly damaging	0.76
IGL02674:Appl1	APN	14	26949461	missense	possibly damaging	0.86
IGL02803:Appl1	APN	14	26951516	missense	possibly damaging	0.93
R0129:Appl1	UTSW	14	26928643	missense	probably damaging	1.00
R0183:Appl1	UTSW	14	26962854	missense	probably damaging	1.00
R0323:Appl1	UTSW	14	26942738	missense	possibly damaging	0.91
R0411:Appl1	UTSW	14	26940256	missense	probably benign
R1213:Appl1	UTSW	14	26943993	missense	probably benign	0.27
R1277:Appl1	UTSW	14	26927856	missense	possibly damaging	0.87
R1668:Appl1	UTSW	14	26923854	missense	probably damaging	1.00
R1856:Appl1	UTSW	14	26927749	missense	probably damaging	1.00
R1889:Appl1	UTSW	14	26925513	splice site	probably benign
R2145:Appl1	UTSW	14	26949619	missense	possibly damaging	0.66
R3720:Appl1	UTSW	14	26927844	missense	probably damaging	1.00
R3722:Appl1	UTSW	14	26927844	missense	probably damaging	1.00
R4700:Appl1	UTSW	14	26925971	missense	probably benign	0.00
R5139:Appl1	UTSW	14	26947155	missense	probably benign	0.04
R5485:Appl1	UTSW	14	26962866	missense	probably damaging	1.00
R5536:Appl1	UTSW	14	26923780	nonsense	probably null
R5795:Appl1	UTSW	14	26942816	missense	probably benign	0.01
R7044:Appl1	UTSW	14	26928677	missense	possibly damaging	0.90
R7318:Appl1	UTSW	14	26963660	missense	probably benign	0.01
R7447:Appl1	UTSW	14	26959452	nonsense	probably null
R7943:Appl1	UTSW	14	26945568	missense	probably benign	0.01
R8110:Appl1	UTSW	14	26927794	nonsense	probably null
R8129:Appl1	UTSW	14	26949509	missense	possibly damaging	0.87
R8160:Appl1	UTSW	14	26928635	missense	probably benign	0.35
R8211:Appl1	UTSW	14	26945598	missense	probably benign	0.18
R8239:Appl1	UTSW	14	26964957	missense	probably damaging	0.99
R8379:Appl1	UTSW	14	26925415	critical splice donor site	probably null
R8464:Appl1	UTSW	14	26953028	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACATAGGACCAGGTTATCATCAAAC -3'
(R):5'- ATGTATTGTGAGTTAAGGCCAACC -3'

Sequencing Primer
(F):5'- TTGGGTCTGCGGATCAAT -3'
(R):5'- GCCAACCTGTGCTGCAAAAATAG -3'

Posted On

2015-04-17