Mutagenetix > Incidental Mutations

Incidental Mutation 'R3917:Shank3'

307381

Institutional Source

Beutler Lab

Gene Symbol

Shank3

Ensembl Gene

ENSMUSG00000022623

Gene Name

SH3 and multiple ankyrin repeat domains 3

Synonyms

MMRRC Submission

040914-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.314) question?

Stock #

R3917 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

89499623-89560261 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 89503384 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 252 (D252G)

Ref Sequence

ENSEMBL: ENSMUSP00000104932 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039074] [ENSMUST00000066545] [ENSMUST00000109309]

Predicted Effect

probably benign
Transcript: ENSMUST00000039074
AA Change: D177G

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000048062
Gene: ENSMUSG00000022623
AA Change: D177G

Domain	Start	End	E-Value	Type
ANK	182	211	1.54e-1	SMART
ANK	215	245	3.36e2	SMART
ANK	249	278	2.47e0	SMART
ANK	282	311	3.71e-4	SMART
ANK	315	345	5.03e2	SMART
low complexity region	434	462	N/A	INTRINSIC
SH3	473	528	1.28e-14	SMART
PDZ	579	664	3.95e-13	SMART
low complexity region	672	684	N/A	INTRINSIC
low complexity region	813	843	N/A	INTRINSIC
low complexity region	857	869	N/A	INTRINSIC
low complexity region	905	923	N/A	INTRINSIC
low complexity region	1078	1092	N/A	INTRINSIC
low complexity region	1109	1121	N/A	INTRINSIC
low complexity region	1173	1194	N/A	INTRINSIC
low complexity region	1235	1252	N/A	INTRINSIC
low complexity region	1266	1278	N/A	INTRINSIC
low complexity region	1318	1332	N/A	INTRINSIC
low complexity region	1341	1355	N/A	INTRINSIC
low complexity region	1370	1395	N/A	INTRINSIC
low complexity region	1409	1427	N/A	INTRINSIC
low complexity region	1552	1558	N/A	INTRINSIC
low complexity region	1584	1599	N/A	INTRINSIC
low complexity region	1626	1658	N/A	INTRINSIC
SAM	1664	1730	3.08e-18	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000066545

SMART Domains

Protein: ENSMUSP00000064477
Gene: ENSMUSG00000022623

Domain	Start	End	E-Value	Type
ANK	109	138	1.54e-1	SMART
ANK	142	172	3.36e2	SMART
ANK	176	205	2.47e0	SMART
ANK	209	238	3.71e-4	SMART
ANK	242	272	5.03e2	SMART
low complexity region	361	389	N/A	INTRINSIC
SH3	400	455	1.28e-14	SMART
PDZ	506	591	3.95e-13	SMART
low complexity region	599	611	N/A	INTRINSIC
low complexity region	625	636	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109309
AA Change: D252G

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000104932
Gene: ENSMUSG00000022623
AA Change: D252G

Domain	Start	End	E-Value	Type
low complexity region	5	55	N/A	INTRINSIC
Pfam:FERM_f0	84	167	2.5e-14	PFAM
ANK	257	286	1.54e-1	SMART
ANK	290	320	3.36e2	SMART
ANK	324	353	2.47e0	SMART
ANK	357	386	3.71e-4	SMART
ANK	390	420	5.03e2	SMART
low complexity region	509	537	N/A	INTRINSIC
SH3	548	603	1.28e-14	SMART
PDZ	654	739	3.95e-13	SMART
low complexity region	747	759	N/A	INTRINSIC
low complexity region	888	918	N/A	INTRINSIC
low complexity region	932	944	N/A	INTRINSIC
low complexity region	980	998	N/A	INTRINSIC
low complexity region	1153	1167	N/A	INTRINSIC
low complexity region	1184	1196	N/A	INTRINSIC
low complexity region	1248	1269	N/A	INTRINSIC
low complexity region	1310	1327	N/A	INTRINSIC
low complexity region	1341	1353	N/A	INTRINSIC
low complexity region	1393	1407	N/A	INTRINSIC
low complexity region	1416	1430	N/A	INTRINSIC
low complexity region	1445	1470	N/A	INTRINSIC
low complexity region	1484	1502	N/A	INTRINSIC
low complexity region	1627	1633	N/A	INTRINSIC
low complexity region	1659	1674	N/A	INTRINSIC
low complexity region	1701	1733	N/A	INTRINSIC
SAM	1739	1805	3.08e-18	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135214

Meta Mutation Damage Score

0.2456

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.0%

Validation Efficiency

97% (74/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Shank gene family. Shank proteins are multidomain scaffold proteins of the postsynaptic density that connect neurotransmitter receptors, ion channels, and other membrane proteins to the actin cytoskeleton and G-protein-coupled signaling pathways. Shank proteins also play a role in synapse formation and dendritic spine maturation. Mutations in this gene are a cause of autism spectrum disorder (ASD), which is characterized by impairments in social interaction and communication, and restricted behavioral patterns and interests. Mutations in this gene also cause schizophrenia type 15, and are a major causative factor in the neurological symptoms of 22q13.3 deletion syndrome, which is also known as Phelan-McDermid syndrome. Additional isoforms have been described for this gene but they have not yet been experimentally verified. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice carrying various deletions of exons encoding the ankyrin repeats (exons 4-9) exhibit a range of synaptic and autism-related impairments. Homozygotes lacking exon 9 show altered excitation/inhibition balance, increased rearing, and mildly impaired spatial memory. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acad12	A	G	5: 121,599,214	V498A	probably damaging	Het
Adam19	A	G	11: 46,060,935	E37G	probably benign	Het
Apol11b	A	G	15: 77,635,304	I192T	probably benign	Het
Appl1	A	T	14: 26,928,604	F537Y	probably damaging	Het
Atad5	A	C	11: 80,103,294	K785N	probably null	Het
Atp1b2	A	G	11: 69,603,075	V93A	probably damaging	Het
Bcam	T	C	7: 19,765,450	Y216C	probably damaging	Het
Brca2	A	G	5: 150,540,827	E1352G	probably damaging	Het
C030005K15Rik	A	C	10: 97,725,591	S93A	unknown	Het
Cadps	C	T	14: 12,457,702	A1060T	probably benign	Het
Ccdc88c	A	G	12: 100,941,107		probably null	Het
Ccdc89	A	G	7: 90,426,825	D81G	probably damaging	Het
Ccnt1	A	G	15: 98,544,059	S443P	probably benign	Het
Cd109	CATTTATTTATTTATTTATTTATTTATTTATTTAT	CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT	9: 78,712,500		probably benign	Het
Cdc42bpa	T	C	1: 180,106,154		probably null	Het
Cdk11b	T	C	4: 155,626,801	S47P	probably damaging	Het
Cfap43	T	C	19: 47,897,750	D142G	probably benign	Het
Cntnap4	C	G	8: 112,875,533	P1190A	probably benign	Het
Colgalt2	T	A	1: 152,508,611	Y567*	probably null	Het
Dner	CGCTGCTGCTGCTGCTGCTGCTGCTGC	CGCTGCTGCTGCTGCTGCTGCTGC	1: 84,585,549		probably benign	Het
Dock7	T	C	4: 99,016,685	Y651C	probably damaging	Het
Fzd3	A	T	14: 65,235,930	F130I	probably damaging	Het
Gabarapl2	T	A	8: 111,952,396	F115L	probably benign	Het
Gm1043	G	A	5: 37,192,941		probably benign	Het
Gm12185	A	G	11: 48,915,933	F144L	probably benign	Het
Gm14124	T	A	2: 150,266,119		probably benign	Het
Gm21961	A	T	15: 65,014,884	D7E	unknown	Het
Gtf3a	A	G	5: 146,955,434	K332E	probably benign	Het
Haao	A	G	17: 83,838,799		probably null	Het
Habp2	T	A	19: 56,311,179	C170S	probably damaging	Het
Heatr3	T	G	8: 88,150,371		probably null	Het
Herc1	T	G	9: 66,434,466	C1846G	possibly damaging	Het
Hivep3	T	C	4: 120,099,427	S1647P	probably benign	Het
Hnrnpul1	C	T	7: 25,726,875	R517Q	probably damaging	Het
Hspg2	A	G	4: 137,559,314	E3648G	probably damaging	Het
Jaml	T	C	9: 45,101,151		probably benign	Het
Jund	C	T	8: 70,699,023		probably benign	Het
Klra14-ps	T	C	6: 130,157,632		noncoding transcript	Het
Krt88	G	A	15: 101,452,928		probably null	Het
Lrp5	G	A	19: 3,612,330	R173C	probably damaging	Het
Lyzl4	T	A	9: 121,583,035	D105V	probably damaging	Het
Mst1	A	G	9: 108,084,295	I575V	probably benign	Het
Myd88	T	C	9: 119,341,398		probably benign	Het
Myo1d	A	T	11: 80,666,578	V512E	probably damaging	Het
Ndufv1	A	G	19: 4,010,002	Y33H	probably damaging	Het
Nwd1	T	A	8: 72,667,811	C608*	probably null	Het
Olfr118	T	A	17: 37,672,793	F257I	probably damaging	Het
Olfr884	A	T	9: 38,047,545	I108F	probably damaging	Het
Patj	A	T	4: 98,592,008	K1317*	probably null	Het
Pld5	A	G	1: 175,963,938	S501P	probably benign	Het
Pnpo	A	G	11: 96,939,757	V146A	probably damaging	Het
Ppdpf	A	G	2: 181,187,728	Y16C	probably benign	Het
Ppp1r27	A	G	11: 120,550,959	V32A	possibly damaging	Het
Rbm28	T	C	6: 29,154,789	D294G	probably benign	Het
Sdk1	T	A	5: 142,051,244	D817E	probably damaging	Het
Slc29a1	A	T	17: 45,588,973		probably null	Het
Slc35a5	G	C	16: 45,158,158		probably benign	Het
Slc6a5	T	C	7: 49,911,869	S50P	probably damaging	Het
Slfn8	A	T	11: 83,016,993	Y241*	probably null	Het
Slu7	G	T	11: 43,440,684		probably null	Het
Smad2	T	A	18: 76,287,937	D82E	probably benign	Het
Spx	A	C	6: 142,414,031	E33A	probably damaging	Het
Tdp1	A	G	12: 99,894,717	Y205C	probably damaging	Het
Tekt1	A	G	11: 72,345,748	I296T	possibly damaging	Het
Tgm1	G	A	14: 55,712,757		probably benign	Het
Tnks	A	G	8: 34,853,361	S719P	probably damaging	Het
Trip6	A	G	5: 137,313,679	C47R	probably benign	Het
Trpv3	A	G	11: 73,283,734	D309G	possibly damaging	Het
Tti2	A	G	8: 31,153,519	K221E	possibly damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Vmn1r57	A	T	7: 5,220,631	N52Y	probably damaging	Het
Vmn2r94	A	G	17: 18,244,358	F557L	probably benign	Het
Zbed5	T	C	5: 129,902,277	Y356H	possibly damaging	Het
Zic4	C	A	9: 91,384,341		probably benign	Het

Other mutations in Shank3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01070:Shank3	APN	15	89549416	missense	probably damaging	1.00
IGL01469:Shank3	APN	15	89521274	missense	probably damaging	1.00
IGL01886:Shank3	APN	15	89531663	missense	probably damaging	1.00
IGL01934:Shank3	APN	15	89549846	missense	probably damaging	1.00
IGL01989:Shank3	APN	15	89503299	splice site	probably benign
IGL02004:Shank3	APN	15	89503299	splice site	probably benign
IGL02085:Shank3	APN	15	89503915	critical splice donor site	probably null
IGL02195:Shank3	APN	15	89548118	missense	probably damaging	1.00
IGL02354:Shank3	APN	15	89504333	missense	probably damaging	1.00
IGL02361:Shank3	APN	15	89504333	missense	probably damaging	1.00
IGL02541:Shank3	APN	15	89501410	missense	probably damaging	1.00
G1citation:Shank3	UTSW	15	89531627	missense	probably damaging	1.00
R0294:Shank3	UTSW	15	89532098	missense	probably damaging	1.00
R0468:Shank3	UTSW	15	89549275	missense	probably benign	0.28
R0483:Shank3	UTSW	15	89543239	splice site	probably benign
R0605:Shank3	UTSW	15	89524147	missense	possibly damaging	0.49
R0675:Shank3	UTSW	15	89531388	missense	possibly damaging	0.92
R1082:Shank3	UTSW	15	89549371	missense	probably damaging	1.00
R1576:Shank3	UTSW	15	89503663	missense	probably benign	0.11
R1702:Shank3	UTSW	15	89499896	missense	probably damaging	0.99
R1726:Shank3	UTSW	15	89557986	missense	probably damaging	1.00
R1958:Shank3	UTSW	15	89503148	missense	probably damaging	0.99
R1961:Shank3	UTSW	15	89557964	missense	possibly damaging	0.60
R2420:Shank3	UTSW	15	89521210	nonsense	probably null
R2513:Shank3	UTSW	15	89548686	missense	probably benign	0.05
R4163:Shank3	UTSW	15	89549594	missense	probably damaging	1.00
R4205:Shank3	UTSW	15	89503318	missense	probably damaging	1.00
R4434:Shank3	UTSW	15	89503359	missense	probably damaging	1.00
R4791:Shank3	UTSW	15	89500354	missense	probably damaging	1.00
R4816:Shank3	UTSW	15	89543115	missense	probably damaging	1.00
R4828:Shank3	UTSW	15	89500199	intron	probably benign
R4911:Shank3	UTSW	15	89504344	missense	probably damaging	1.00
R4997:Shank3	UTSW	15	89549698	missense	probably damaging	1.00
R5213:Shank3	UTSW	15	89533278	missense	possibly damaging	0.82
R5338:Shank3	UTSW	15	89531711	splice site	probably null
R5494:Shank3	UTSW	15	89548238	missense	probably damaging	0.99
R5543:Shank3	UTSW	15	89532354	missense	probably damaging	1.00
R5654:Shank3	UTSW	15	89521326	missense	probably benign	0.07
R5900:Shank3	UTSW	15	89503390	missense	probably damaging	1.00
R5906:Shank3	UTSW	15	89548916	missense	probably damaging	1.00
R6385:Shank3	UTSW	15	89521375	critical splice donor site	probably null
R6432:Shank3	UTSW	15	89503413	missense	possibly damaging	0.75
R6724:Shank3	UTSW	15	89532453	missense	probably damaging	1.00
R6822:Shank3	UTSW	15	89531627	missense	probably damaging	1.00
R6845:Shank3	UTSW	15	89548325	missense	probably benign	0.00
R7088:Shank3	UTSW	15	89503525	splice site	probably null
R7390:Shank3	UTSW	15	89549312	missense	probably benign	0.05
R7808:Shank3	UTSW	15	89548880	missense	probably damaging	1.00
R7862:Shank3	UTSW	15	89505445	missense	possibly damaging	0.73
R8039:Shank3	UTSW	15	89505439	missense	probably damaging	1.00
R8090:Shank3	UTSW	15	89505458	critical splice donor site	probably null
R8170:Shank3	UTSW	15	89548840	missense	possibly damaging	0.69
R8189:Shank3	UTSW	15	89549236	missense	probably benign
R8246:Shank3	UTSW	15	89533346	missense	possibly damaging	0.90
R8515:Shank3	UTSW	15	89503572	nonsense	probably null
R8525:Shank3	UTSW	15	89547770	missense	probably damaging	0.99
R8537:Shank3	UTSW	15	89532215	missense	probably damaging	1.00
RF020:Shank3	UTSW	15	89500390	missense	probably benign	0.20
Z1177:Shank3	UTSW	15	89558322	makesense	probably null

Predicted Primers

PCR Primer
(F):5'- TACACAGCACAGATAAGGTGGC -3'
(R):5'- GTCCTTGTAGTCAGGCGAAG -3'

Sequencing Primer
(F):5'- GGCTGGACCCCAATTTCCATG -3'
(R):5'- GAAGCCCCCAGGTCCAG -3'

Posted On

2015-04-17