Incidental Mutation 'R3917:Habp2'
ID307393
Institutional Source Beutler Lab
Gene Symbol Habp2
Ensembl Gene ENSMUSG00000025075
Gene Namehyaluronic acid binding protein 2
SynonymsFSAP
MMRRC Submission 040914-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R3917 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location56287137-56320822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 56311179 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 170 (C170S)
Ref Sequence ENSEMBL: ENSMUSP00000126235 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078284] [ENSMUST00000095948] [ENSMUST00000163502] [ENSMUST00000165522] [ENSMUST00000166049] [ENSMUST00000171341]
Predicted Effect probably damaging
Transcript: ENSMUST00000078284
AA Change: C170S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077402
Gene: ENSMUSG00000025075
AA Change: C170S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 28 42 N/A INTRINSIC
EGF 70 103 4.66e-6 SMART
EGF 108 142 3.97e0 SMART
EGF 147 182 2.26e-4 SMART
KR 186 272 2.72e-39 SMART
Tryp_SPc 307 544 1.47e-90 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000095948
AA Change: C133S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093641
Gene: ENSMUSG00000025075
AA Change: C133S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EGF 33 66 4.66e-6 SMART
EGF 71 105 3.97e0 SMART
EGF 110 145 2.26e-4 SMART
KR 149 235 2.72e-39 SMART
Tryp_SPc 270 507 1.47e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163502
SMART Domains Protein: ENSMUSP00000128964
Gene: ENSMUSG00000025075

DomainStartEndE-ValueType
KR 1 41 5.87e-6 SMART
Tryp_SPc 76 220 5.6e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165407
Predicted Effect probably benign
Transcript: ENSMUST00000165522
SMART Domains Protein: ENSMUSP00000130809
Gene: ENSMUSG00000025075

DomainStartEndE-ValueType
Pfam:Trypsin 41 106 6.4e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166049
AA Change: C170S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132444
Gene: ENSMUSG00000025075
AA Change: C170S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 28 42 N/A INTRINSIC
EGF 70 103 4.66e-6 SMART
EGF 108 142 3.97e0 SMART
EGF 147 182 2.26e-4 SMART
KR 186 272 2.72e-39 SMART
Tryp_SPc 302 539 1.47e-90 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171341
AA Change: C170S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126235
Gene: ENSMUSG00000025075
AA Change: C170S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 28 42 N/A INTRINSIC
EGF 70 103 4.66e-6 SMART
EGF 108 142 3.97e0 SMART
EGF 147 182 2.26e-4 SMART
KR 186 272 2.72e-39 SMART
Meta Mutation Damage Score 0.9688 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase S1 family of serine proteases. The encoded preproprotein is secreted by hepatocytes and proteolytically processed to generate heavy and light chains that form the mature heterodimer. Further autoproteolysis leads to smaller, inactive peptides. This extracellular protease binds hyaluronic acid and may play a role in the coagulation and fibrinolysis systems. Mutations in this gene are associated with nonmedullary thyroid cancer and susceptibility to venous thromboembolism. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased lethality but increased liver fibrosis, inflammation and injury following bile duct ligation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad12 A G 5: 121,599,214 V498A probably damaging Het
Adam19 A G 11: 46,060,935 E37G probably benign Het
Apol11b A G 15: 77,635,304 I192T probably benign Het
Appl1 A T 14: 26,928,604 F537Y probably damaging Het
Atad5 A C 11: 80,103,294 K785N probably null Het
Atp1b2 A G 11: 69,603,075 V93A probably damaging Het
Bcam T C 7: 19,765,450 Y216C probably damaging Het
Brca2 A G 5: 150,540,827 E1352G probably damaging Het
C030005K15Rik A C 10: 97,725,591 S93A unknown Het
Cadps C T 14: 12,457,702 A1060T probably benign Het
Ccdc88c A G 12: 100,941,107 probably null Het
Ccdc89 A G 7: 90,426,825 D81G probably damaging Het
Ccnt1 A G 15: 98,544,059 S443P probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdc42bpa T C 1: 180,106,154 probably null Het
Cdk11b T C 4: 155,626,801 S47P probably damaging Het
Cfap43 T C 19: 47,897,750 D142G probably benign Het
Cntnap4 C G 8: 112,875,533 P1190A probably benign Het
Colgalt2 T A 1: 152,508,611 Y567* probably null Het
Dner CGCTGCTGCTGCTGCTGCTGCTGCTGC CGCTGCTGCTGCTGCTGCTGCTGC 1: 84,585,549 probably benign Het
Dock7 T C 4: 99,016,685 Y651C probably damaging Het
Fzd3 A T 14: 65,235,930 F130I probably damaging Het
Gabarapl2 T A 8: 111,952,396 F115L probably benign Het
Gm1043 G A 5: 37,192,941 probably benign Het
Gm12185 A G 11: 48,915,933 F144L probably benign Het
Gm14124 T A 2: 150,266,119 probably benign Het
Gm21961 A T 15: 65,014,884 D7E unknown Het
Gtf3a A G 5: 146,955,434 K332E probably benign Het
Haao A G 17: 83,838,799 probably null Het
Heatr3 T G 8: 88,150,371 probably null Het
Herc1 T G 9: 66,434,466 C1846G possibly damaging Het
Hivep3 T C 4: 120,099,427 S1647P probably benign Het
Hnrnpul1 C T 7: 25,726,875 R517Q probably damaging Het
Hspg2 A G 4: 137,559,314 E3648G probably damaging Het
Jaml T C 9: 45,101,151 probably benign Het
Jund C T 8: 70,699,023 probably benign Het
Klra14-ps T C 6: 130,157,632 noncoding transcript Het
Krt88 G A 15: 101,452,928 probably null Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Lyzl4 T A 9: 121,583,035 D105V probably damaging Het
Mst1 A G 9: 108,084,295 I575V probably benign Het
Myd88 T C 9: 119,341,398 probably benign Het
Myo1d A T 11: 80,666,578 V512E probably damaging Het
Ndufv1 A G 19: 4,010,002 Y33H probably damaging Het
Nwd1 T A 8: 72,667,811 C608* probably null Het
Olfr118 T A 17: 37,672,793 F257I probably damaging Het
Olfr884 A T 9: 38,047,545 I108F probably damaging Het
Patj A T 4: 98,592,008 K1317* probably null Het
Pld5 A G 1: 175,963,938 S501P probably benign Het
Pnpo A G 11: 96,939,757 V146A probably damaging Het
Ppdpf A G 2: 181,187,728 Y16C probably benign Het
Ppp1r27 A G 11: 120,550,959 V32A possibly damaging Het
Rbm28 T C 6: 29,154,789 D294G probably benign Het
Sdk1 T A 5: 142,051,244 D817E probably damaging Het
Shank3 A G 15: 89,503,384 D252G possibly damaging Het
Slc29a1 A T 17: 45,588,973 probably null Het
Slc35a5 G C 16: 45,158,158 probably benign Het
Slc6a5 T C 7: 49,911,869 S50P probably damaging Het
Slfn8 A T 11: 83,016,993 Y241* probably null Het
Slu7 G T 11: 43,440,684 probably null Het
Smad2 T A 18: 76,287,937 D82E probably benign Het
Spx A C 6: 142,414,031 E33A probably damaging Het
Tdp1 A G 12: 99,894,717 Y205C probably damaging Het
Tekt1 A G 11: 72,345,748 I296T possibly damaging Het
Tgm1 G A 14: 55,712,757 probably benign Het
Tnks A G 8: 34,853,361 S719P probably damaging Het
Trip6 A G 5: 137,313,679 C47R probably benign Het
Trpv3 A G 11: 73,283,734 D309G possibly damaging Het
Tti2 A G 8: 31,153,519 K221E possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn1r57 A T 7: 5,220,631 N52Y probably damaging Het
Vmn2r94 A G 17: 18,244,358 F557L probably benign Het
Zbed5 T C 5: 129,902,277 Y356H possibly damaging Het
Zic4 C A 9: 91,384,341 probably benign Het
Other mutations in Habp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Habp2 APN 19 56317832 missense probably damaging 1.00
IGL01113:Habp2 APN 19 56310116 missense probably benign 0.13
IGL01737:Habp2 APN 19 56316307 missense probably benign 0.00
IGL02174:Habp2 APN 19 56311737 missense probably damaging 0.96
IGL02250:Habp2 APN 19 56308929 missense probably benign 0.00
IGL02706:Habp2 APN 19 56310138 critical splice donor site probably null
IGL02953:Habp2 APN 19 56314232 critical splice donor site probably null
IGL02986:Habp2 APN 19 56311192 missense probably benign 0.25
IGL03010:Habp2 APN 19 56311223 critical splice donor site probably null
R0415:Habp2 UTSW 19 56317717 unclassified probably benign
R0483:Habp2 UTSW 19 56316432 unclassified probably benign
R0627:Habp2 UTSW 19 56314046 missense probably damaging 1.00
R1188:Habp2 UTSW 19 56311722 missense probably benign 0.39
R1880:Habp2 UTSW 19 56317828 missense possibly damaging 0.83
R2214:Habp2 UTSW 19 56317817 missense possibly damaging 0.88
R2473:Habp2 UTSW 19 56288032 missense possibly damaging 0.92
R2869:Habp2 UTSW 19 56287991 unclassified probably benign
R2871:Habp2 UTSW 19 56287991 unclassified probably benign
R3969:Habp2 UTSW 19 56311701 missense probably damaging 1.00
R4014:Habp2 UTSW 19 56319622 missense probably benign 0.04
R4853:Habp2 UTSW 19 56311191 unclassified probably null
R5835:Habp2 UTSW 19 56306786 missense probably benign 0.16
R6270:Habp2 UTSW 19 56306863 missense possibly damaging 0.93
R6390:Habp2 UTSW 19 56306823 missense possibly damaging 0.63
R7110:Habp2 UTSW 19 56311164 nonsense probably null
R7268:Habp2 UTSW 19 56314086 missense probably damaging 1.00
R7456:Habp2 UTSW 19 56319525 missense probably damaging 1.00
R7583:Habp2 UTSW 19 56311804 missense probably benign 0.03
R8021:Habp2 UTSW 19 56314053 missense probably benign 0.04
Z1176:Habp2 UTSW 19 56317760 missense probably damaging 1.00
Z1177:Habp2 UTSW 19 56319553 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GTATCAATGATCTGTCTGTGCCC -3'
(R):5'- ATAGGCTCTGTGCTCTGAGG -3'

Sequencing Primer
(F):5'- CCCTATGTTGTTCCGTCATTTAGGAG -3'
(R):5'- GCTCTGAGGTTGGAAGACTAG -3'
Posted On2015-04-17