Mutagenetix > Incidental Mutations

Incidental Mutation 'R3940:Casq1'

307397

Institutional Source

Beutler Lab

Gene Symbol

Casq1

Ensembl Gene

ENSMUSG00000007122

Gene Name

calsequestrin 1

Synonyms

CSQ-1, CSQ1, CSQ, sCSQ

MMRRC Submission

040922-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3940 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

172209894-172219868 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 172219536 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 52 (V52A)

Ref Sequence

ENSEMBL: ENSMUSP00000129647 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003554] [ENSMUST00000111243] [ENSMUST00000170700]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000003554
AA Change: V52A

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000003554
Gene: ENSMUSG00000007122
AA Change: V52A

Domain	Start	End	E-Value	Type
Pfam:Calsequestrin	11	402	5.3e-238	PFAM
Pfam:Thioredoxin_6	186	379	2e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000111243

SMART Domains

Protein: ENSMUSP00000106874
Gene: ENSMUSG00000007107

Domain	Start	End	E-Value	Type
low complexity region	33	50	N/A	INTRINSIC
Cation_ATPase_N	51	125	1.22e-14	SMART
Pfam:E1-E2_ATPase	144	375	2.6e-59	PFAM
Pfam:Hydrolase	380	738	8.1e-19	PFAM
Pfam:HAD	383	735	1.6e-17	PFAM
Pfam:Cation_ATPase	437	531	9.2e-25	PFAM
Pfam:Cation_ATPase_C	808	1017	1.2e-47	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000170700
AA Change: V52A

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000129647
Gene: ENSMUSG00000007122
AA Change: V52A

Domain	Start	End	E-Value	Type
Pfam:Calsequestrin	11	94	9.7e-38	PFAM
Pfam:Calsequestrin	89	156	6.9e-38	PFAM

Meta Mutation Damage Score

0.3319

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

95% (35/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the skeletal muscle specific member of the calsequestrin protein family. Calsequestrin functions as a luminal sarcoplasmic reticulum calcium sensor in both cardiac and skeletal muscle cells. This protein, also known as calmitine, functions as a calcium regulator in the mitochondria of skeletal muscle. This protein is absent in patients with Duchenne and Becker types of muscular dystrophy. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for an insertional mutation that inactivates the gene exhibit structural alterations of the Ca2+ release units, an increased frequency of mitochondria, and significantly impaired calcium handling in skeletal muscle. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930567H17Rik	C	T	X: 70,394,529	A53T	probably benign	Het
Acsm3	A	G	7: 119,773,886	E204G	probably benign	Het
Acta2	A	T	19: 34,243,480	I276N	possibly damaging	Het
Ankrd16	T	C	2: 11,784,381	C260R	probably benign	Het
Ankrd42	T	C	7: 92,591,788		probably null	Het
Atp13a2	T	C	4: 141,006,422	S1041P	probably damaging	Het
Brinp3	C	A	1: 146,751,861	D277E	probably damaging	Het
Calm5	A	T	13: 3,854,485	I37F	possibly damaging	Het
Col22a1	A	T	15: 71,981,933	L260*	probably null	Het
Cttnbp2	C	A	6: 18,420,975	V846L	probably benign	Het
Dnah12	A	G	14: 26,723,599	T627A	probably benign	Het
Eogt	T	C	6: 97,113,914	I421M	probably damaging	Het
Fam135a	T	A	1: 24,057,475	H63L	probably damaging	Het
Fmo3	T	A	1: 162,963,986	T241S	probably benign	Het
Frem3	T	C	8: 80,615,020	I1314T	possibly damaging	Het
Gm14393	T	C	2: 175,061,627		probably null	Het
Kcna5	C	T	6: 126,533,651	V505I	probably damaging	Het
Kit	A	G	5: 75,609,318	D130G	probably benign	Het
Neto2	G	A	8: 85,674,118	T16I	probably damaging	Het
Olfr1090	T	A	2: 86,753,931	D269V	possibly damaging	Het
Olfr57	T	A	10: 79,035,204	I136N	probably damaging	Het
Pcdhb7	T	C	18: 37,343,968	L719P	probably damaging	Het
Pcdhga9	G	A	18: 37,738,942	R608H	probably benign	Het
Pik3ip1	A	G	11: 3,331,987	N48S	probably damaging	Het
Pkn2	G	A	3: 142,793,911	S951L	probably damaging	Het
Prrc2a	T	C	17: 35,157,498	H772R	possibly damaging	Het
Ric1	T	C	19: 29,570,762	Y277H	probably damaging	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Rnf123	A	T	9: 108,064,035		probably benign	Het
Robo1	T	C	16: 73,009,743	S1166P	probably benign	Het
S100a10	A	G	3: 93,561,076	E38G	probably benign	Het
Slc34a1	A	T	13: 55,413,170	I483F	probably damaging	Het
Stim1	A	G	7: 102,435,641	N600S	probably benign	Het
Ube3c	T	A	5: 29,619,360	N517K	probably benign	Het

Other mutations in Casq1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02165:Casq1	APN	1	172213381	missense	probably damaging	0.96
IGL02699:Casq1	APN	1	172219696	start gained	probably benign
IGL02756:Casq1	APN	1	172215105	missense	probably damaging	1.00
PIT4377001:Casq1	UTSW	1	172212001	missense	probably benign	0.15
R0026:Casq1	UTSW	1	172219400	splice site	probably benign
R0026:Casq1	UTSW	1	172219400	splice site	probably benign
R0124:Casq1	UTSW	1	172210425	missense	probably damaging	1.00
R0485:Casq1	UTSW	1	172210390	unclassified	probably benign
R1982:Casq1	UTSW	1	172215530	missense	probably damaging	1.00
R2095:Casq1	UTSW	1	172215962	missense	probably benign	0.26
R2097:Casq1	UTSW	1	172210421	missense	probably damaging	1.00
R4654:Casq1	UTSW	1	172210398	unclassified	probably benign
R4790:Casq1	UTSW	1	172216837	missense	probably damaging	1.00
R5002:Casq1	UTSW	1	172213378	missense	possibly damaging	0.50
R5187:Casq1	UTSW	1	172213074	missense	possibly damaging	0.54
R5307:Casq1	UTSW	1	172219416	missense	probably damaging	1.00
R5973:Casq1	UTSW	1	172219501	missense	probably damaging	1.00
R6251:Casq1	UTSW	1	172216840	missense	probably benign	0.17
R6768:Casq1	UTSW	1	172219678	missense	probably benign	0.04
R7380:Casq1	UTSW	1	172216849	missense	probably benign	0.07
Z1176:Casq1	UTSW	1	172215914	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TACTTGGTGGAGACAGAGGC -3'
(R):5'- GATTGTACTACCTCCATGAGAGC -3'

Sequencing Primer
(F):5'- TCAGACTCAGGGCTCACC -3'
(R):5'- TGTACTACCTCCATGAGAGCTACCG -3'

Posted On

2015-04-17