Mutagenetix > Incidental Mutation

Incidental Mutation 'R3940:Stim1'

307411

Institutional Source

Beutler Lab

Gene Symbol

Stim1

Ensembl Gene

ENSMUSG00000030987

Gene Name

stromal interaction molecule 1

Synonyms

SIM

MMRRC Submission

040922-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3940 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

102267806-102437319 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 102435641 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 600 (N600S)

Ref Sequence

ENSEMBL: ENSMUSP00000033289 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033289] [ENSMUST00000209255] [ENSMUST00000211457]

AlphaFold

P70302

Predicted Effect

probably benign
Transcript: ENSMUST00000033289
AA Change: N600S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000033289
Gene: ENSMUSG00000030987
AA Change: N600S

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	32	47	N/A	INTRINSIC
SAM	129	200	5.51e-6	SMART
SCOP:d1eq1a_	229	334	1e-2	SMART
PDB:4O9B\|D	237	340	3e-59	PDB
Pfam:SOAR	341	441	1.4e-46	PFAM
low complexity region	485	499	N/A	INTRINSIC
low complexity region	601	631	N/A	INTRINSIC
low complexity region	672	685	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000209255
AA Change: N708S

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210544

Predicted Effect

probably benign
Transcript: ENSMUST00000211058

Predicted Effect

probably benign
Transcript: ENSMUST00000211457

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

95% (35/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type 1 transmembrane protein that mediates Ca2+ influx after depletion of intracellular Ca2+ stores by gating of store-operated Ca2+ influx channels (SOCs). It is one of several genes located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocrotical carcinoma, and lung, ovarian, and breast cancer. This gene may play a role in malignancies and disease that involve this region, as well as early hematopoiesis, by mediating attachment to stromal cells. Mutations in this gene are associated with fatal classic Kaposi sarcoma, immunodeficiency due to defects in store-operated calcium entry (SOCE) in fibroblasts, ectodermal dysplasia and tubular aggregate myopathy. This gene is oriented in a head-to-tail configuration with the ribonucleotide reductase 1 gene (RRM1), with the 3' end of this gene situated 1.6 kb from the 5' end of the RRM1 gene. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit perinatal and postnatal lethality, with all mice dying by 2 weeks of age, and severe growth retardation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930567H17Rik	C	T	X: 70,394,529	A53T	probably benign	Het
Acsm3	A	G	7: 119,773,886	E204G	probably benign	Het
Acta2	A	T	19: 34,243,480	I276N	possibly damaging	Het
Ankrd16	T	C	2: 11,784,381	C260R	probably benign	Het
Ankrd42	T	C	7: 92,591,788		probably null	Het
Atp13a2	T	C	4: 141,006,422	S1041P	probably damaging	Het
Brinp3	C	A	1: 146,751,861	D277E	probably damaging	Het
Calm5	A	T	13: 3,854,485	I37F	possibly damaging	Het
Casq1	A	G	1: 172,219,536	V52A	possibly damaging	Het
Col22a1	A	T	15: 71,981,933	L260*	probably null	Het
Cttnbp2	C	A	6: 18,420,975	V846L	probably benign	Het
Dnah12	A	G	14: 26,723,599	T627A	probably benign	Het
Eogt	T	C	6: 97,113,914	I421M	probably damaging	Het
Fam135a	T	A	1: 24,057,475	H63L	probably damaging	Het
Fmo3	T	A	1: 162,963,986	T241S	probably benign	Het
Frem3	T	C	8: 80,615,020	I1314T	possibly damaging	Het
Gm14393	T	C	2: 175,061,627		probably null	Het
Kcna5	C	T	6: 126,533,651	V505I	probably damaging	Het
Kit	A	G	5: 75,609,318	D130G	probably benign	Het
Neto2	G	A	8: 85,674,118	T16I	probably damaging	Het
Olfr1090	T	A	2: 86,753,931	D269V	possibly damaging	Het
Olfr57	T	A	10: 79,035,204	I136N	probably damaging	Het
Pcdhb7	T	C	18: 37,343,968	L719P	probably damaging	Het
Pcdhga9	G	A	18: 37,738,942	R608H	probably benign	Het
Pik3ip1	A	G	11: 3,331,987	N48S	probably damaging	Het
Pkn2	G	A	3: 142,793,911	S951L	probably damaging	Het
Prrc2a	T	C	17: 35,157,498	H772R	possibly damaging	Het
Ric1	T	C	19: 29,570,762	Y277H	probably damaging	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Rnf123	A	T	9: 108,064,035		probably benign	Het
Robo1	T	C	16: 73,009,743	S1166P	probably benign	Het
S100a10	A	G	3: 93,561,076	E38G	probably benign	Het
Slc34a1	A	T	13: 55,413,170	I483F	probably damaging	Het
Ube3c	T	A	5: 29,619,360	N517K	probably benign	Het

Other mutations in Stim1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Stim1	APN	7	102426747	missense	probably damaging	1.00
IGL01390:Stim1	APN	7	102427162	missense	possibly damaging	0.73
IGL01602:Stim1	APN	7	102386115	missense	possibly damaging	0.86
IGL01605:Stim1	APN	7	102386115	missense	possibly damaging	0.86
IGL01697:Stim1	APN	7	102425969	splice site	probably benign
IGL01826:Stim1	APN	7	102427075	splice site	probably benign
IGL01908:Stim1	APN	7	102435650	missense	probably benign
IGL02869:Stim1	APN	7	102268551	missense	unknown
IGL03146:Stim1	APN	7	102421355	missense	probably damaging	1.00
R0217:Stim1	UTSW	7	102435800	missense	probably benign	0.00
R1320:Stim1	UTSW	7	102408406	missense	possibly damaging	0.79
R1639:Stim1	UTSW	7	102354541	missense	probably benign	0.31
R1643:Stim1	UTSW	7	102386100	missense	possibly damaging	0.92
R1697:Stim1	UTSW	7	102354506	missense	probably damaging	1.00
R2424:Stim1	UTSW	7	102408405	missense	probably benign	0.03
R3838:Stim1	UTSW	7	102411296	missense	possibly damaging	0.71
R4820:Stim1	UTSW	7	102415364	missense	probably damaging	0.97
R4871:Stim1	UTSW	7	102354572	missense	probably damaging	1.00
R5110:Stim1	UTSW	7	102268422	missense	unknown
R5787:Stim1	UTSW	7	102435440	missense	possibly damaging	0.52
R6400:Stim1	UTSW	7	102430950	missense	probably null	0.99
R6788:Stim1	UTSW	7	102427291	missense	probably damaging	0.99
R7112:Stim1	UTSW	7	102408408	missense	probably benign	0.01
R7125:Stim1	UTSW	7	102435534	missense	possibly damaging	0.69
R7247:Stim1	UTSW	7	102421532	critical splice donor site	probably null
R7650:Stim1	UTSW	7	102428827	missense
R7807:Stim1	UTSW	7	102427141	missense	probably damaging	0.99
R8304:Stim1	UTSW	7	102435481	missense	possibly damaging	0.55
R8462:Stim1	UTSW	7	102427117	missense	probably damaging	1.00
R8528:Stim1	UTSW	7	102431082	intron	probably benign
R8883:Stim1	UTSW	7	102431050	missense	unknown
R8921:Stim1	UTSW	7	102421390	missense	probably damaging	0.99
R8924:Stim1	UTSW	7	102428807	missense
R9018:Stim1	UTSW	7	102411275	missense	probably benign	0.05
R9164:Stim1	UTSW	7	102435419	missense	probably benign	0.35
R9396:Stim1	UTSW	7	102415385	missense	possibly damaging	0.63
R9487:Stim1	UTSW	7	102431050	missense	unknown
R9501:Stim1	UTSW	7	102411299	missense	possibly damaging	0.92
R9697:Stim1	UTSW	7	102428807	missense
R9710:Stim1	UTSW	7	102430911	small deletion	probably benign
R9734:Stim1	UTSW	7	102415353	missense	possibly damaging	0.56

Predicted Primers

PCR Primer
(F):5'- GCAGATGAAGCTCTCAATGCC -3'
(R):5'- TGCCTACTTCTTAAGAGGCTTC -3'

Sequencing Primer
(F):5'- AATGCCATGCCTTCCAATGG -3'
(R):5'- GAGTCTGTCTCCTCACCAATGGAAC -3'

Posted On

2015-04-17