Incidental Mutation 'R3940:Neto2'
ID 307414
Institutional Source Beutler Lab
Gene Symbol Neto2
Ensembl Gene ENSMUSG00000036902
Gene Name neuropilin (NRP) and tolloid (TLL)-like 2
Synonyms 5530601C23Rik
MMRRC Submission 040922-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.164) question?
Stock # R3940 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 86363217-86427553 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 86400747 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 16 (T16I)
Ref Sequence ENSEMBL: ENSMUSP00000148172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109686] [ENSMUST00000209479] [ENSMUST00000216286]
AlphaFold Q8BNJ6
Predicted Effect possibly damaging
Transcript: ENSMUST00000109686
AA Change: T51I

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105308
Gene: ENSMUSG00000036902
AA Change: T51I

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
CUB 80 194 2.56e-40 SMART
CUB 205 320 9.11e-5 SMART
LDLa 324 361 5.73e-5 SMART
transmembrane domain 374 396 N/A INTRINSIC
coiled coil region 432 460 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209259
Predicted Effect probably damaging
Transcript: ENSMUST00000209479
AA Change: T16I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215046
Predicted Effect probably benign
Transcript: ENSMUST00000216286
AA Change: T16I

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.0759 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 95% (35/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a predicted transmembrane protein containing two extracellular CUB domains followed by a low-density lipoprotein class A (LDLa) domain. A similar gene in rats encodes a protein that modulates glutamate signaling in the brain by regulating kainate receptor function. Expression of this gene may be a biomarker for proliferating infantile hemangiomas. A pseudogene of this gene is located on the long arm of chromosome 8. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a null mutation show normal brain morphology and kainate receptor mediated excitatory postsynaptic currents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 69,438,135 (GRCm39) A53T probably benign Het
Acsm3 A G 7: 119,373,109 (GRCm39) E204G probably benign Het
Acta2 A T 19: 34,220,880 (GRCm39) I276N possibly damaging Het
Ankrd16 T C 2: 11,789,192 (GRCm39) C260R probably benign Het
Ankrd42 T C 7: 92,240,996 (GRCm39) probably null Het
Atp13a2 T C 4: 140,733,733 (GRCm39) S1041P probably damaging Het
Brinp3 C A 1: 146,627,599 (GRCm39) D277E probably damaging Het
Calm5 A T 13: 3,904,485 (GRCm39) I37F possibly damaging Het
Casq1 A G 1: 172,047,103 (GRCm39) V52A possibly damaging Het
Col22a1 A T 15: 71,853,782 (GRCm39) L260* probably null Het
Cttnbp2 C A 6: 18,420,974 (GRCm39) V846L probably benign Het
Dnah12 A G 14: 26,444,754 (GRCm39) T627A probably benign Het
Eogt T C 6: 97,090,875 (GRCm39) I421M probably damaging Het
Fam135a T A 1: 24,096,556 (GRCm39) H63L probably damaging Het
Fmo3 T A 1: 162,791,555 (GRCm39) T241S probably benign Het
Frem3 T C 8: 81,341,649 (GRCm39) I1314T possibly damaging Het
Gm14393 T C 2: 174,903,420 (GRCm39) probably null Het
Kcna5 C T 6: 126,510,614 (GRCm39) V505I probably damaging Het
Kit A G 5: 75,769,978 (GRCm39) D130G probably benign Het
Or7a41 T A 10: 78,871,038 (GRCm39) I136N probably damaging Het
Or8k40 T A 2: 86,584,275 (GRCm39) D269V possibly damaging Het
Pcdhb7 T C 18: 37,477,021 (GRCm39) L719P probably damaging Het
Pcdhga9 G A 18: 37,871,995 (GRCm39) R608H probably benign Het
Pik3ip1 A G 11: 3,281,987 (GRCm39) N48S probably damaging Het
Pkn2 G A 3: 142,499,672 (GRCm39) S951L probably damaging Het
Prrc2a T C 17: 35,376,474 (GRCm39) H772R possibly damaging Het
Ric1 T C 19: 29,548,162 (GRCm39) Y277H probably damaging Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
Rnf123 A T 9: 107,941,234 (GRCm39) probably benign Het
Robo1 T C 16: 72,806,631 (GRCm39) S1166P probably benign Het
S100a10 A G 3: 93,468,383 (GRCm39) E38G probably benign Het
Slc34a1 A T 13: 55,560,983 (GRCm39) I483F probably damaging Het
Stim1 A G 7: 102,084,848 (GRCm39) N600S probably benign Het
Ube3c T A 5: 29,824,358 (GRCm39) N517K probably benign Het
Other mutations in Neto2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01705:Neto2 APN 8 86,367,632 (GRCm39) missense probably damaging 1.00
IGL01938:Neto2 APN 8 86,417,484 (GRCm39) missense probably benign 0.00
IGL02238:Neto2 APN 8 86,396,292 (GRCm39) missense probably damaging 0.99
IGL02605:Neto2 APN 8 86,390,064 (GRCm39) splice site probably benign
IGL02813:Neto2 APN 8 86,417,515 (GRCm39) missense probably benign
R0138:Neto2 UTSW 8 86,367,673 (GRCm39) missense possibly damaging 0.72
R1934:Neto2 UTSW 8 86,397,033 (GRCm39) missense possibly damaging 0.96
R2402:Neto2 UTSW 8 86,417,541 (GRCm39) missense probably benign 0.00
R2423:Neto2 UTSW 8 86,396,396 (GRCm39) missense probably damaging 1.00
R3821:Neto2 UTSW 8 86,389,924 (GRCm39) nonsense probably null
R3822:Neto2 UTSW 8 86,389,924 (GRCm39) nonsense probably null
R3883:Neto2 UTSW 8 86,389,894 (GRCm39) missense probably damaging 1.00
R3939:Neto2 UTSW 8 86,400,747 (GRCm39) missense probably damaging 0.99
R3941:Neto2 UTSW 8 86,400,747 (GRCm39) missense probably damaging 0.99
R4433:Neto2 UTSW 8 86,367,712 (GRCm39) missense probably damaging 1.00
R4668:Neto2 UTSW 8 86,367,691 (GRCm39) missense probably damaging 1.00
R4675:Neto2 UTSW 8 86,396,333 (GRCm39) missense probably damaging 1.00
R4908:Neto2 UTSW 8 86,396,393 (GRCm39) missense probably damaging 0.99
R5459:Neto2 UTSW 8 86,397,112 (GRCm39) missense probably benign 0.35
R5471:Neto2 UTSW 8 86,367,389 (GRCm39) missense probably benign 0.41
R5544:Neto2 UTSW 8 86,374,506 (GRCm39) missense possibly damaging 0.94
R5571:Neto2 UTSW 8 86,367,173 (GRCm39) missense probably damaging 1.00
R6083:Neto2 UTSW 8 86,367,214 (GRCm39) missense probably benign 0.00
R6339:Neto2 UTSW 8 86,367,187 (GRCm39) missense probably benign 0.33
R6381:Neto2 UTSW 8 86,369,138 (GRCm39) missense probably damaging 0.99
R6572:Neto2 UTSW 8 86,397,033 (GRCm39) missense possibly damaging 0.96
R6593:Neto2 UTSW 8 86,396,175 (GRCm39) missense probably damaging 1.00
R6662:Neto2 UTSW 8 86,389,844 (GRCm39) missense probably damaging 1.00
R6881:Neto2 UTSW 8 86,367,185 (GRCm39) missense probably damaging 1.00
R6950:Neto2 UTSW 8 86,397,072 (GRCm39) missense probably damaging 1.00
R7121:Neto2 UTSW 8 86,397,020 (GRCm39) splice site probably null
R7754:Neto2 UTSW 8 86,396,329 (GRCm39) missense probably damaging 0.98
R7755:Neto2 UTSW 8 86,396,285 (GRCm39) missense probably damaging 1.00
R8682:Neto2 UTSW 8 86,367,295 (GRCm39) missense probably benign 0.01
R9326:Neto2 UTSW 8 86,369,063 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTCATTGCAATATTCAAGAACAA -3'
(R):5'- AATGCTGGTGAGGACTGGT -3'

Sequencing Primer
(F):5'- GCTGTACAATGTGAGACTGCC -3'
(R):5'- AGGACTGGTGATTTTTAAGCCAAG -3'
Posted On 2015-04-17